MCRS1 cdna clone
MCRS1 cDNA Clone
Gene Names
MCRS1; P78; MCRS2; MSP58; INO80Q; ICP22BP
Synonyms
MCRS1; MCRS1 cDNA Clone; MCRS1 cdna clone
Sequence
atggacaaagattctcaggggctgctagattcatccctgatggcatcaggcactgccagccgctcagaggatgaggagtcactggcagggcagaagcgagcctcctcccaggccttgggcaccatccctaaacggagaagctcctccaggttcatcaagaggaagaagttcgatgatgagctggtggagagcagcctggcaaaatcttctacccgggcaaagggggccagtggggtggaaccagggcgctgttcggggagtgaaccctcctccagtgagaagaagaaggtatccaaagcccccagcactcctgtgccacccagcccagccccagcccctggactcaccaagcgtgtgaagaagagtaaacagccacttcaggtgaccaaggatctgggccgctggaagcctgcagatgacctcctgctcataaatgctgtgttgcagaccaacgacctgacctccgtccacctgggcgtgaaattcagctgccgcttcacccttcgggaggtccaggagcgttggtacgccctgctctacgatcctgtcatctccaagttggcctgtcaggccatgaggcagctgcacccagaggctattgcagccatccagagcaaggccctgtttagcaaggctgaggagcagctgctgagcaaagtgggatcgaccagccagcccaccttggagaccttccaggacctgctgcacagacaccctgatgccttctacctggcccgtaccgcgaaggccctgcaggcccactggcagctcatgaagcagtattacctgctggaggaccagacagtgcagccgctgcccaaaggggaccaagtgctgaacttctctgatgcagaggacctgattgatgacagtaagctcaaggacatgcgagatgaggtcctggaacatgagctgatggtggctgaccggcgccagaagcgagagattcggcagctggaacaggaactgcataagtggcaggtgctagtggacagcatcacaggcatgagctctccggacttcgacaaccagacactggcagtgctgcggggccgcatggtgcggtacctgatgcgctcgcgtgagatcaccctgggcagagcaaccaaggataaccagattgatgtggacctgtctctggagggtccggcctggaagatatcccggaaacaaggtgtcatcaagctgaagaacaacggtgatttcttcattgccaatgagggtcgacggcccatctacatcgatggacggccggtgctctgtggctccaaatggcgcctcagcaacaactctgtggtggagatcgccagcctgcgattcgtcttccttatcaaccaggacctcattgccctcatcagggctgaggctgccaagatcacaccacagtga
Sequence Length
1389
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
31,134 Da
NCBI Official Full Name
Homo sapiens microspherule protein 1, mRNA
NCBI Official Synonym Full Names
microspherule protein 1
NCBI Official Symbol
MCRS1
NCBI Official Synonym Symbols
P78; MCRS2; MSP58; INO80Q; ICP22BP
NCBI Protein Information
microspherule protein 1
UniProt Protein Name
Microspherule protein 1
Protein Family
UniProt Gene Name
MCRS1
UniProt Synonym Gene Names
INO80Q; MSP58
UniProt Entry Name
MCRS1_HUMAN
Uniprot Description
MCRS1: Modulates the transcription repressor activity of DAXX by recruiting it to the nucleolus. As part of the NSL complex it may be involved in acetylation of nucleosomal histone H4 on several lysine residues. Putative regulatory component of the chromatin remodeling INO80 complex which is involved in transcriptional regulation, DNA replication and probably DNA repair. May also be an inhibitor of TERT telomerase activity. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: RNA-binding; Nucleolus; Nuclear receptor co-regulator
Chromosomal Location of Human Ortholog: 12q13.12
Cellular Component: actin cytoskeleton; cell junction; cytoplasm; dendrite; histone acetyltransferase complex; nucleolus; nucleoplasm; nucleus; perikaryon; polysome
Molecular Function: histone acetyltransferase activity (H4-K16 specific); poly(rG) binding; poly(U) binding; protein binding
Biological Process: protein modification process
Research Articles on MCRS1
Similar Products
Product Notes
The MCRS1 mcrs1 (Catalog #AAA1266351) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacaaag attctcaggg gctgctagat tcatccctga tggcatcagg cactgccagc cgctcagagg atgaggagtc actggcaggg cagaagcgag cctcctccca ggccttgggc accatcccta aacggagaag ctcctccagg ttcatcaaga ggaagaagtt cgatgatgag ctggtggaga gcagcctggc aaaatcttct acccgggcaa agggggccag tggggtggaa ccagggcgct gttcggggag tgaaccctcc tccagtgaga agaagaaggt atccaaagcc cccagcactc ctgtgccacc cagcccagcc ccagcccctg gactcaccaa gcgtgtgaag aagagtaaac agccacttca ggtgaccaag gatctgggcc gctggaagcc tgcagatgac ctcctgctca taaatgctgt gttgcagacc aacgacctga cctccgtcca cctgggcgtg aaattcagct gccgcttcac ccttcgggag gtccaggagc gttggtacgc cctgctctac gatcctgtca tctccaagtt ggcctgtcag gccatgaggc agctgcaccc agaggctatt gcagccatcc agagcaaggc cctgtttagc aaggctgagg agcagctgct gagcaaagtg ggatcgacca gccagcccac cttggagacc ttccaggacc tgctgcacag acaccctgat gccttctacc tggcccgtac cgcgaaggcc ctgcaggccc actggcagct catgaagcag tattacctgc tggaggacca gacagtgcag ccgctgccca aaggggacca agtgctgaac ttctctgatg cagaggacct gattgatgac agtaagctca aggacatgcg agatgaggtc ctggaacatg agctgatggt ggctgaccgg cgccagaagc gagagattcg gcagctggaa caggaactgc ataagtggca ggtgctagtg gacagcatca caggcatgag ctctccggac ttcgacaacc agacactggc agtgctgcgg ggccgcatgg tgcggtacct gatgcgctcg cgtgagatca ccctgggcag agcaaccaag gataaccaga ttgatgtgga cctgtctctg gagggtccgg cctggaagat atcccggaaa caaggtgtca tcaagctgaa gaacaacggt gatttcttca ttgccaatga gggtcgacgg cccatctaca tcgatggacg gccggtgctc tgtggctcca aatggcgcct cagcaacaac tctgtggtgg agatcgccag cctgcgattc gtcttcctta tcaaccagga cctcattgcc ctcatcaggg ctgaggctgc caagatcaca ccacagtga. It is sometimes possible for the material contained within the vial of "MCRS1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
