Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MCEE cdna clone

MCEE cDNA Clone

Gene Names
MCEE; GLOD2
Synonyms
MCEE; MCEE cDNA Clone; MCEE cdna clone
Ordering
For Research Use Only!
Sequence
atggcgcgggtgctgaaggctgcagccgcgaatgccgtagggcttttttccagacttcaagctcccattccaacagtaagagcttcttccacatcacagcccttggatcaagtgacaggttctgtgtggaacctgggtcgactcaaccatgtagccatagcagtgccagatttggaaaaggctgcagcattttataagaatattctgggggcccaggtaagtgaagcggtccctcttcctgaacatggagtatctgttgtttttgtcaacctgggaaataccaagatggaactgcttcatccattgggacttgacagtccaattgcaggttttctgcagaaaaacaaggctggaggaatgcatcacatctgcatcgaggtggataatattaatgcagctgtgatggatttgaaaaaaaagaagatccgcagtctaagtgaagaggtcaaaataggagcacatggaaaaccagtgatttttctccatcctaaagactgtggtggagtccttgtggaactggagcaagcttga
Sequence Length
531
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
18,749 Da
NCBI Official Full Name
Homo sapiens methylmalonyl CoA epimerase, mRNA
NCBI Official Synonym Full Names
methylmalonyl-CoA epimerase
NCBI Official Symbol
MCEE
NCBI Official Synonym Symbols
GLOD2
NCBI Protein Information
methylmalonyl-CoA epimerase, mitochondrial
UniProt Protein Name
Methylmalonyl-CoA epimerase, mitochondrial
UniProt Gene Name
MCEE
UniProt Entry Name
MCEE_HUMAN

NCBI Description

The product of this gene catalyzes the interconversion of D- and L-methylmalonyl-CoA during the degradation of branched chain amino acids. odd chain-length fatty acids, and other metabolites. Mutations in this gene result in methylmalonyl-CoA epimerase deficiency, which is presented as mild to moderate methylmalonic aciduria. [provided by RefSeq, Jul 2008]

Uniprot Description

MCEE: Defects in MCEE are a cause of methylmalonyl-CoA epimerase deficiency (MCEED); also known as methylmalonyl-CoA racemase deficiency or methylmalonic aciduria type 3. MCEE deficiency is an autosomal recessive inborn error of amino acid metabolism, involving valine, threonine, isoleucine and methionine. This organic aciduria may present in the neonatal period with life-threatening metabolic acidosis, hyperammonemia, feeding difficulties, pancytopenia and coma. Belongs to the glyoxalase I family.

Protein type: EC 5.1.99.1; Mitochondrial; Isomerase; Carbohydrate Metabolism - propanoate; Amino Acid Metabolism - valine, leucine and isoleucine degradation

Chromosomal Location of Human Ortholog: 2p13.3

Cellular Component: mitochondrial matrix

Molecular Function: methylmalonyl-CoA epimerase activity; protein binding

Biological Process: L-methylmalonyl-CoA metabolic process; short-chain fatty acid catabolic process

Disease: Methylmalonyl-coa Epimerase Deficiency

Research Articles on MCEE

Similar Products

Product Notes

The MCEE mcee (Catalog #AAA1270556) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgcggg tgctgaaggc tgcagccgcg aatgccgtag ggcttttttc cagacttcaa gctcccattc caacagtaag agcttcttcc acatcacagc ccttggatca agtgacaggt tctgtgtgga acctgggtcg actcaaccat gtagccatag cagtgccaga tttggaaaag gctgcagcat tttataagaa tattctgggg gcccaggtaa gtgaagcggt ccctcttcct gaacatggag tatctgttgt ttttgtcaac ctgggaaata ccaagatgga actgcttcat ccattgggac ttgacagtcc aattgcaggt tttctgcaga aaaacaaggc tggaggaatg catcacatct gcatcgaggt ggataatatt aatgcagctg tgatggattt gaaaaaaaag aagatccgca gtctaagtga agaggtcaaa ataggagcac atggaaaacc agtgattttt ctccatccta aagactgtgg tggagtcctt gtggaactgg agcaagcttg a. It is sometimes possible for the material contained within the vial of "MCEE, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.