Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MCCC2 cdna clone

MCCC2 cDNA Clone

Gene Names
MCCC2; MCCB
Synonyms
MCCC2; MCCC2 cDNA Clone; MCCC2 cdna clone
Ordering
For Research Use Only!
Sequence
atgtgggccgtcctgaggttagccctgcggccgtgtgcccgcgcctctcccgccgggccgcgcgcctatcacggggactcggtggcctcgctgggcacccagccggacttgggctctgccctctaccaggagaactacaagcagatgaaagcactagtaaatcagctccatgaacgagtggagcatataaaactaggaggtggtgagaaagcccgagcacttcacatatcaagaggaaaactattgcccagagaaagaattgacaatctcatagacccagggtctccatttctggaattatcccagtttgcaggttaccagttatatgacaatgaggaggtgccaggaggtggcattattacaggcattggaagagtatcaggagtagaatgcatgattattgccaatgatgccaccgtcaaaggaggtgcctactacccagtgactgtgaaaaaacaattacgggcccaagaaattgccatgcaaaacaggctcccctgcatctacttagttgattcgggaggagcatacttacctcgacaagcagatgtgtttccagatcgagaccactttggccgtacattctataatcaggcaattatgtcttctaaaaatattgcacagatcgcagtggtcatgggctcctgcaccgcaggaggagcctatgtgcctgccatggctgatgaaaacatcattgtacgcaagcagggtaccattttcttggcaggaccccccttggttaaagcggcaactggggaagaagtatctgctgaggatcttggaggtgctgatcttcattgcagaaagtctggagtaagtgaccactgggctttggatgatcatcatgcccttcacttaactaggaaggttgtgaggaatctaaattatcagaagaaattggatgtcaccattgaaccttctgaagagcctttatttcctgctgatgaattgtatggaatagttggtgctaaccttaagaggagctttgatgtccgagaggtcattgctagaatcgtggatggaagcagattcactgagttcaaagccttttatggagacacattagttacaggatttgctcgaatatttgggtacccagtaggtatcgttggaaacaacggagttctcttttctgaatctgcaaaaaagggtactcactttgtccagttatgctgccaaagaaatattcctctgctgttccttcaaaacattactggatttatggttggtagagagtatgaagctgaaggaattgccaaggatggtgccaagatggtggccgctgtggcctgtgcccaagtgcctaagataaccctcatcattgggggctcctatggagccggaaactatgggatgtgtggcagagcgtatagcccaagatttctctacatttggccaaatgctcgtatctcagtgatgggaggagagcaggcagccaatgtgttggccacgataacaaaggaccaaagagcccgggaaggaaagcagttctccagtgctgatgaagcggctttaaaagagcccatcattaagaagtttgaagaggaaggaaacccttactattccagcgcaagggtatgggatgatgggatcattgatccagcagacaccagactggtcttgggtctcagttttagtgcagccctcaacgcaccaatagagaagactgacttcggtatcttcaggatgtaa
Sequence Length
1692
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
57,519 Da
NCBI Official Full Name
Homo sapiens methylcrotonoyl-Coenzyme A carboxylase 2 (beta), mRNA
NCBI Official Synonym Full Names
methylcrotonoyl-CoA carboxylase 2
NCBI Official Symbol
MCCC2
NCBI Official Synonym Symbols
MCCB
NCBI Protein Information
methylcrotonoyl-CoA carboxylase beta chain, mitochondrial
UniProt Protein Name
Methylcrotonoyl-CoA carboxylase beta chain, mitochondrial
UniProt Gene Name
MCCC2
UniProt Synonym Gene Names
MCCB; MCCase subunit beta
UniProt Entry Name
MCCB_HUMAN

NCBI Description

This gene encodes the small subunit of 3-methylcrotonyl-CoA carboxylase. This enzyme functions as a heterodimer and catalyzes the carboxylation of 3-methylcrotonyl-CoA to form 3-methylglutaconyl-CoA. Mutations in this gene are associated with 3-Methylcrotonylglycinuria, an autosomal recessive disorder of leucine catabolism. [provided by RefSeq, Jul 2008]

Uniprot Description

MCCC2: Defects in MCCC2 are the cause of methylcrotonoyl-CoA carboxylase 2 deficiency (MCC2D). An autosomal recessive disorder of leucine catabolism. The phenotype is variable, ranging from neonatal onset with severe neurological involvement to asymptomatic adults. There is a characteristic organic aciduria with massive excretion of 3-hydroxyisovaleric acid and 3-methylcrotonylglycine, usually in combination with a severe secondary carnitine deficiency. Belongs to the AccD/PCCB family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Mitochondrial; Ligase; Amino Acid Metabolism - valine, leucine and isoleucine degradation; EC 6.4.1.4

Chromosomal Location of Human Ortholog: 5q12-q13

Cellular Component: cytosol; mitochondrial matrix; mitochondrion

Molecular Function: methylcrotonoyl-CoA carboxylase activity; protein binding

Biological Process: biotin metabolic process; branched chain family amino acid catabolic process; leucine catabolic process

Disease: 3-methylcrotonyl-coa Carboxylase 2 Deficiency

Research Articles on MCCC2

Similar Products

Product Notes

The MCCC2 mccc2 (Catalog #AAA1267619) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtgggccg tcctgaggtt agccctgcgg ccgtgtgccc gcgcctctcc cgccgggccg cgcgcctatc acggggactc ggtggcctcg ctgggcaccc agccggactt gggctctgcc ctctaccagg agaactacaa gcagatgaaa gcactagtaa atcagctcca tgaacgagtg gagcatataa aactaggagg tggtgagaaa gcccgagcac ttcacatatc aagaggaaaa ctattgccca gagaaagaat tgacaatctc atagacccag ggtctccatt tctggaatta tcccagtttg caggttacca gttatatgac aatgaggagg tgccaggagg tggcattatt acaggcattg gaagagtatc aggagtagaa tgcatgatta ttgccaatga tgccaccgtc aaaggaggtg cctactaccc agtgactgtg aaaaaacaat tacgggccca agaaattgcc atgcaaaaca ggctcccctg catctactta gttgattcgg gaggagcata cttacctcga caagcagatg tgtttccaga tcgagaccac tttggccgta cattctataa tcaggcaatt atgtcttcta aaaatattgc acagatcgca gtggtcatgg gctcctgcac cgcaggagga gcctatgtgc ctgccatggc tgatgaaaac atcattgtac gcaagcaggg taccattttc ttggcaggac cccccttggt taaagcggca actggggaag aagtatctgc tgaggatctt ggaggtgctg atcttcattg cagaaagtct ggagtaagtg accactgggc tttggatgat catcatgccc ttcacttaac taggaaggtt gtgaggaatc taaattatca gaagaaattg gatgtcacca ttgaaccttc tgaagagcct ttatttcctg ctgatgaatt gtatggaata gttggtgcta accttaagag gagctttgat gtccgagagg tcattgctag aatcgtggat ggaagcagat tcactgagtt caaagccttt tatggagaca cattagttac aggatttgct cgaatatttg ggtacccagt aggtatcgtt ggaaacaacg gagttctctt ttctgaatct gcaaaaaagg gtactcactt tgtccagtta tgctgccaaa gaaatattcc tctgctgttc cttcaaaaca ttactggatt tatggttggt agagagtatg aagctgaagg aattgccaag gatggtgcca agatggtggc cgctgtggcc tgtgcccaag tgcctaagat aaccctcatc attgggggct cctatggagc cggaaactat gggatgtgtg gcagagcgta tagcccaaga tttctctaca tttggccaaa tgctcgtatc tcagtgatgg gaggagagca ggcagccaat gtgttggcca cgataacaaa ggaccaaaga gcccgggaag gaaagcagtt ctccagtgct gatgaagcgg ctttaaaaga gcccatcatt aagaagtttg aagaggaagg aaacccttac tattccagcg caagggtatg ggatgatggg atcattgatc cagcagacac cagactggtc ttgggtctca gttttagtgc agccctcaac gcaccaatag agaagactga cttcggtatc ttcaggatgt aa. It is sometimes possible for the material contained within the vial of "MCCC2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.