Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MBOAT7 cdna clone

MBOAT7 cDNA Clone

Gene Names
MBOAT7; BB1; LRC4; LENG4; LPIAT; MBOA7; OACT7; hMBOA-7
Synonyms
MBOAT7; MBOAT7 cDNA Clone; MBOAT7 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcgcctgaagaatggacgtatctagtggttcttcttatctccatccccatcggcttcctctttaagaaagccggtcctgggctgaagagatggggagcagccgctgtgggcctggggctcaccctgttcacctgtggcccccacactttgcattctctggtcaccatcctcgggacctgggccctcattcaggcccagccctgctcctgccacgccctggctctggcctggactttctcctatctcctgttcttccgagccctcagcctcctgggcctgcccactcccacgcccttcaccaatgccgtccagctgctgctgacgctgaagctggtgagcctggccagtgaagtccaggacctgcatctggcccagaggaaggaaatggcctcaggcttcagcaaggggcccaccctggggctgctgcccgacgtgccctccctgatggagacactcagctacagctactgctacgtgggaatcatgacaggcccgttcttccgctaccgcacctacctggactggctggagcagcccttccccggggcagtgcccagcctgcggcccctgctgcgccgcgcctggccggccccgctcttcggcctgctgttcctgctctcctctcacctcttcccgctggaggccgtgcgcgaggacgccttctacgcccgcccgctgcccgcccgcctcttctacatgatccccgtcttcttcgccttccgcatgcgcttctacgtggcctggattgccgccgagtgcggctgcattgccgccggccttggggcctaccccgtggccgccaaagcccgggccggaggcggccccaccctccaatgcccaccccccagcagtccggagaaggcggcttccttggagtatgactatgagaccatccgcaacatcgactgctacagcacagatttctgcgtgcgggtgcgcgatggcatgcggtactggaacatgacggtgcagtggtggctggcgcagtatatctacaagagcgcacctgcccgttcctatgtcctgcggtga
Sequence Length
1035
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
38,470 Da
NCBI Official Full Name
Homo sapiens membrane bound O-acyltransferase domain containing 7, mRNA
NCBI Official Synonym Full Names
membrane bound O-acyltransferase domain containing 7
NCBI Official Symbol
MBOAT7
NCBI Official Synonym Symbols
BB1; LRC4; LENG4; LPIAT; MBOA7; OACT7; hMBOA-7
NCBI Protein Information
lysophospholipid acyltransferase 7
UniProt Protein Name
Lysophospholipid acyltransferase 7
UniProt Gene Name
MBOAT7
UniProt Synonym Gene Names
BB1; LENG4; OACT7; LPLAT 7; LPIAT; Lyso-PI acyltransferase; O-acyltransferase domain-containing protein 7; h-mboa-7
UniProt Entry Name
MBOA7_HUMAN

NCBI Description

This gene encodes a member of the membrane-bound O-acyltransferases family of integral membrane proteins that have acyltransferase activity. The encoded protein is a lysophosphatidylinositol acyltransferase that has specificity for arachidonoyl-CoA as an acyl donor. This protein is involved in the reacylation of phospholipids as part of the phospholipid remodeling pathway known as the Land cycle. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2009]

Uniprot Description

LENG4: Acyltransferase which mediates the conversion of lysophosphatidylinositol (1-acylglycerophosphatidylinositol or LPI) into phosphatidylinositol (1,2-diacyl-sn-glycero-3- phosphoinositol or PI) (LPIAT activity). Prefers arachidonoyl-CoA as the acyl donor. Lysophospholipid acyltransferases (LPLATs) catalyze the reacylation step of the phospholipid remodeling pathway also known as the Lands cycle. Belongs to the membrane-bound acyltransferase family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, multi-pass; Transferase; EC 2.3.1.n4; Membrane protein, integral

Chromosomal Location of Human Ortholog: 19q13.4

Cellular Component: endoplasmic reticulum membrane; membrane

Molecular Function: 1-acylglycerol-3-phosphate O-acyltransferase activity; 2-acylglycerol-3-phosphate O-acyltransferase activity; protein binding

Research Articles on MBOAT7

Similar Products

Product Notes

The MBOAT7 mboat7 (Catalog #AAA1278940) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcgcctg aagaatggac gtatctagtg gttcttctta tctccatccc catcggcttc ctctttaaga aagccggtcc tgggctgaag agatggggag cagccgctgt gggcctgggg ctcaccctgt tcacctgtgg cccccacact ttgcattctc tggtcaccat cctcgggacc tgggccctca ttcaggccca gccctgctcc tgccacgccc tggctctggc ctggactttc tcctatctcc tgttcttccg agccctcagc ctcctgggcc tgcccactcc cacgcccttc accaatgccg tccagctgct gctgacgctg aagctggtga gcctggccag tgaagtccag gacctgcatc tggcccagag gaaggaaatg gcctcaggct tcagcaaggg gcccaccctg gggctgctgc ccgacgtgcc ctccctgatg gagacactca gctacagcta ctgctacgtg ggaatcatga caggcccgtt cttccgctac cgcacctacc tggactggct ggagcagccc ttccccgggg cagtgcccag cctgcggccc ctgctgcgcc gcgcctggcc ggccccgctc ttcggcctgc tgttcctgct ctcctctcac ctcttcccgc tggaggccgt gcgcgaggac gccttctacg cccgcccgct gcccgcccgc ctcttctaca tgatccccgt cttcttcgcc ttccgcatgc gcttctacgt ggcctggatt gccgccgagt gcggctgcat tgccgccggc cttggggcct accccgtggc cgccaaagcc cgggccggag gcggccccac cctccaatgc ccacccccca gcagtccgga gaaggcggct tccttggagt atgactatga gaccatccgc aacatcgact gctacagcac agatttctgc gtgcgggtgc gcgatggcat gcggtactgg aacatgacgg tgcagtggtg gctggcgcag tatatctaca agagcgcacc tgcccgttcc tatgtcctgc ggtga. It is sometimes possible for the material contained within the vial of "MBOAT7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.