Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MAPKAPK5 cdna clone

MAPKAPK5 cDNA Clone

Gene Names
MAPKAPK5; MK5; MK-5; PRAK; MAPKAP-K5
Synonyms
MAPKAPK5; MAPKAPK5 cDNA Clone; MAPKAPK5 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcggaggagagcgacatggacaaagccatcaaggaaacttccattttagaagaatacagtatcaattggactcagaagctgggagctggaattagtggtccagttagagtctgtgtaaagaaatctactcaagaacggtttgcgctgaaaattcttcttgatcgtccaaaagctagaaatgaggtacgtctgcacatgatgtgtgccacacacccaaacatagttcagattattgaagtgtttgctaacagtgtccagtttccccatgagtccagccctagggcccgactcttaattgtaatggagatgatggaagggggagagctatttcacagaatcagccagcaccggcactttacagagaagcaagccagccaagtaacaaagcagatagctttggctctgcggcactgtcacttgttaaacattgcgcacagagacctcaagcctgaaaatctgctttttaaggataactctttggatgccccagtgaagttgtgtgactttggatttgccaagattgaccaaggtgacttgatgacaccccagttcaccccttattatgtagcaccccaggtactggaggcgcaaagaaggcatcagaaggagaaatctggcatcatacctacctcaccgacgccctacacttacaacaagagctgtgacttgtggtccctaggggtgattatctatgtgatgctgtgcggataccctcctttttactccaaacaccacagccggactatcccaaaggatatgcgaagaaagatcatgacaggcagttttgagttcccagaggaagagtggagtcagatctcagagatggccaaagatgttgtgaggaagctcctgaaggtcaaaccggaggagagactcaccatcgagggagtgctggaccacccctggctcaattccaccgaggccctggataatgtgctgccttctgctcagctgatgatggacaaggcagtggttgcaggaatccagcaggctcacgcggaacagttggccaacatgagaatccaggatctgaaagtcagcctcaaacccctgcactcagtgaacaaccccattctgcggaagaggaagttacttggcaccaagccaaaggacagtgtctatatccacgaccatgagaatggagccgaggattccaatgttgccttggaaaaactccgagatgtgattgctcagtgtattctcccccaggctggagagaatgaagatgagaaactgaatgaagtaatgcaggaggcttggaagtataaccgggaatgcaaactcctaagagatactctgcagagcttcagctggaatggtcgtggattcacagataaagtagatcgactaaaactggcagaaattgtgaagcaggtgatagaagagcaaaccacgtcccacgaatcccaataa
Sequence Length
1416
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
54,035 Da
NCBI Official Full Name
Homo sapiens mitogen-activated protein kinase-activated protein kinase 5, mRNA
NCBI Official Synonym Full Names
mitogen-activated protein kinase-activated protein kinase 5
NCBI Official Symbol
MAPKAPK5
NCBI Official Synonym Symbols
MK5; MK-5; PRAK; MAPKAP-K5
NCBI Protein Information
MAP kinase-activated protein kinase 5
UniProt Protein Name
MAP kinase-activated protein kinase 5
UniProt Gene Name
MAPKAPK5
UniProt Synonym Gene Names
PRAK; MAPK-activated protein kinase 5; MAPKAP kinase 5; MAPKAP-K5; MAPKAPK-5; MK-5; MK5; PRAK
UniProt Entry Name
MAPK5_HUMAN

NCBI Description

The protein encoded by this gene is a tumor suppressor and member of the serine/threonine kinase family. In response to cellular stress and proinflammatory cytokines, this kinase is activated through its phosphorylation by MAP kinases including MAPK1/ERK, MAPK14/p38-alpha, and MAPK11/p38-beta. The encoded protein is found in the nucleus but translocates to the cytoplasm upon phosphorylation and activation. This kinase phosphorylates heat shock protein HSP27 at its physiologically relevant sites. Two alternately spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Nov 2012]

Uniprot Description

MAPKAPK5: a member of the MAPKAPK family of protein kinases. Activated through phosphorylation by MAP kinases including ERK, p38-alpha, and MAPp38-beta In response to cellular stress and proinflammatory cytokines. Two alternately spliced transcript variants of this gene encoding distinct isoforms have been reported.

Protein type: Protein kinase, CAMK; Tumor suppressor; Protein kinase, Ser/Thr (non-receptor); Kinase, protein; EC 2.7.11.1; CAMK group; MAPKAPK family; MAPKAPK subfamily

Chromosomal Location of Human Ortholog: 12q24.13

Cellular Component: cytoplasm; cytosol; nucleoplasm; nucleus

Molecular Function: calcium-dependent protein serine/threonine kinase activity; calmodulin binding; calmodulin-dependent protein kinase activity; MAP kinase kinase activity; p53 binding; protein binding; protein serine/threonine kinase activity

Biological Process: negative regulation of TOR signaling pathway; peptidyl-serine phosphorylation; positive regulation of telomerase activity; positive regulation of telomere maintenance via telomerase; protein amino acid autophosphorylation; Ras protein signal transduction; regulation of translation; signal transduction

Research Articles on MAPKAPK5

Similar Products

Product Notes

The MAPKAPK5 mapkapk5 (Catalog #AAA1270964) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcggagg agagcgacat ggacaaagcc atcaaggaaa cttccatttt agaagaatac agtatcaatt ggactcagaa gctgggagct ggaattagtg gtccagttag agtctgtgta aagaaatcta ctcaagaacg gtttgcgctg aaaattcttc ttgatcgtcc aaaagctaga aatgaggtac gtctgcacat gatgtgtgcc acacacccaa acatagttca gattattgaa gtgtttgcta acagtgtcca gtttccccat gagtccagcc ctagggcccg actcttaatt gtaatggaga tgatggaagg gggagagcta tttcacagaa tcagccagca ccggcacttt acagagaagc aagccagcca agtaacaaag cagatagctt tggctctgcg gcactgtcac ttgttaaaca ttgcgcacag agacctcaag cctgaaaatc tgctttttaa ggataactct ttggatgccc cagtgaagtt gtgtgacttt ggatttgcca agattgacca aggtgacttg atgacacccc agttcacccc ttattatgta gcaccccagg tactggaggc gcaaagaagg catcagaagg agaaatctgg catcatacct acctcaccga cgccctacac ttacaacaag agctgtgact tgtggtccct aggggtgatt atctatgtga tgctgtgcgg ataccctcct ttttactcca aacaccacag ccggactatc ccaaaggata tgcgaagaaa gatcatgaca ggcagttttg agttcccaga ggaagagtgg agtcagatct cagagatggc caaagatgtt gtgaggaagc tcctgaaggt caaaccggag gagagactca ccatcgaggg agtgctggac cacccctggc tcaattccac cgaggccctg gataatgtgc tgccttctgc tcagctgatg atggacaagg cagtggttgc aggaatccag caggctcacg cggaacagtt ggccaacatg agaatccagg atctgaaagt cagcctcaaa cccctgcact cagtgaacaa ccccattctg cggaagagga agttacttgg caccaagcca aaggacagtg tctatatcca cgaccatgag aatggagccg aggattccaa tgttgccttg gaaaaactcc gagatgtgat tgctcagtgt attctccccc aggctggaga gaatgaagat gagaaactga atgaagtaat gcaggaggct tggaagtata accgggaatg caaactccta agagatactc tgcagagctt cagctggaat ggtcgtggat tcacagataa agtagatcga ctaaaactgg cagaaattgt gaagcaggtg atagaagagc aaaccacgtc ccacgaatcc caataa. It is sometimes possible for the material contained within the vial of "MAPKAPK5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.