Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MAPK4 cdna clone

MAPK4 cDNA Clone

Gene Names
MAPK4; ERK4; ERK-4; PRKM4; p63MAPK; p63-MAPK
Synonyms
MAPK4; MAPK4 cDNA Clone; MAPK4 cdna clone
Ordering
For Research Use Only!
Sequence
atggctgagaagggtgactgcatcgccagtgtctatgggtatgacctcggtgggcgctttgttgacttccaacccctgggcttcggtgtcaatggtttggtgctgtcggccgtggacagccgggcctgccggaaggtcgctgtgaagaagattgccctgagcgatgcccgcagcatgaagcacgcgctccgagagatcaagatcattcggcgcctggaccacgacaacatcgtcaaagtgtacgaggtgctcggtcccaagggcactgacctgcagggtgagctgttcaagttcagcgtggcgtacatcgtccaggagtacatggagaccgacctggcacgcctgctggagcagggcacgctggcagaagagcatgccaagctgttcatgtaccagctgctccgcgggctcaagtacatccactccgccaacgtgctgcacagggacctgaagcccgccaacatcttcatcagcacagaggacctcgtgctcaagattggggatttcgggttggcaaggatcgttgatcagcattactcccacaagggttatctgtcagaagggttggtaacaaagtggtaccgttccccacgactgctcctttcccccaataactacaccaaagccatcgacatgtgggccgccggctgcatcctggctgagatgcttacggggagaatgctctttgctggggcccatgagctggagcagatgcaactcatcctggagaccatccctgtaatccgggaggaagacaaggacgagctgctcagggtgatgccttcctttgtcagcagcacctgggaggtgaagaggcctctgcgcaagctgctccctgaagtgaacagtgaagccatcgactttctggagaagatcctgacctttaaccccatggatcgcctaacagctgagatggggctgcaacacccctacatgagcccatactcgtgccctgaggacgagcccacctcacaacaccccttccgcattgaggatgagatcgacgacatcgtgctgatggccgctaaccagagccagctgtccaactgggacacgtgcagttccaggtaccctgtgagcctgtcgtcggacctggagtggcggcctgaccggtgccaggacgccagcgaggtacagcgcgacccgcgcgcgggttcggcgccactggctgaggacgtgcaggtggacccgcgcaaggactcgcacagcagctccgagcgcttcctagagcagtcgcactcgtccatggagcgcgccttcgaggccgactacgggcgctcctgcgactacaaggtggggtcgccgtcctacctggacaagctgctgtggcgcgacaacaagccgcaccactactcggagcccaagctcatcctggacctgtcgcactggaagcaggcggccggcgcgccccccacggccacggggctggcggacacgggggcgcgcgaggacgagccggccagcctcttcctggagatcgcgcagtgggtcaagagcacgcagggcggcccagagcacgccagcccgcccgccgacgaccccgagcgccgcttgtctgcctcgccccccggccgcccggccccggtggacggcggcgccagcccccagttcgacctggacgtgttcatctcccgcgccctgaagctctgcaccaagcccgaggacctgccggacaataaactgggcgacctcaatggtgcgtgcatccccgagcaccctggcgacctcgtgcagaccgaggccttctccaaagaaaggtggtga
Sequence Length
1764
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
65,922 Da
NCBI Official Full Name
Homo sapiens mitogen-activated protein kinase 4, mRNA
NCBI Official Synonym Full Names
mitogen-activated protein kinase 4
NCBI Official Symbol
MAPK4
NCBI Official Synonym Symbols
ERK4; ERK-4; PRKM4; p63MAPK; p63-MAPK
NCBI Protein Information
mitogen-activated protein kinase 4
UniProt Protein Name
Mitogen-activated protein kinase 4
UniProt Gene Name
MAPK4
UniProt Synonym Gene Names
ERK4; PRKM4; MAP kinase 4; MAPK 4; ERK-4; p63-MAPK
UniProt Entry Name
MK04_HUMAN

NCBI Description

Mitogen-activated protein kinase 4 is a member of the mitogen-activated protein kinase family. Tyrosine kinase growth factor receptors activate mitogen-activated protein kinases which then translocate into the nucleus and phosphorylate nuclear targets. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]

Uniprot Description

ERK4: a protein kinase of the MAPK family. Phosphorylation and activations leads to translocation into the nucleus where it phosphorylates nuclear targets.

Protein type: EC 2.7.11.24; Protein kinase, Ser/Thr (non-receptor); Kinase, protein; Protein kinase, CMGC; CMGC group; MAPK family; ERK subfamily; MAPK/ERK subfamily

Chromosomal Location of Human Ortholog: 18q21.1

Cellular Component: cytoplasm; cytosol; nucleoplasm; nucleus

Molecular Function: protein binding; protein homodimerization activity; protein kinase binding; protein serine/threonine kinase activity

Biological Process: protein amino acid phosphorylation

Research Articles on MAPK4

Similar Products

Product Notes

The MAPK4 mapk4 (Catalog #AAA1276126) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgaga agggtgactg catcgccagt gtctatgggt atgacctcgg tgggcgcttt gttgacttcc aacccctggg cttcggtgtc aatggtttgg tgctgtcggc cgtggacagc cgggcctgcc ggaaggtcgc tgtgaagaag attgccctga gcgatgcccg cagcatgaag cacgcgctcc gagagatcaa gatcattcgg cgcctggacc acgacaacat cgtcaaagtg tacgaggtgc tcggtcccaa gggcactgac ctgcagggtg agctgttcaa gttcagcgtg gcgtacatcg tccaggagta catggagacc gacctggcac gcctgctgga gcagggcacg ctggcagaag agcatgccaa gctgttcatg taccagctgc tccgcgggct caagtacatc cactccgcca acgtgctgca cagggacctg aagcccgcca acatcttcat cagcacagag gacctcgtgc tcaagattgg ggatttcggg ttggcaagga tcgttgatca gcattactcc cacaagggtt atctgtcaga agggttggta acaaagtggt accgttcccc acgactgctc ctttccccca ataactacac caaagccatc gacatgtggg ccgccggctg catcctggct gagatgctta cggggagaat gctctttgct ggggcccatg agctggagca gatgcaactc atcctggaga ccatccctgt aatccgggag gaagacaagg acgagctgct cagggtgatg ccttcctttg tcagcagcac ctgggaggtg aagaggcctc tgcgcaagct gctccctgaa gtgaacagtg aagccatcga ctttctggag aagatcctga cctttaaccc catggatcgc ctaacagctg agatggggct gcaacacccc tacatgagcc catactcgtg ccctgaggac gagcccacct cacaacaccc cttccgcatt gaggatgaga tcgacgacat cgtgctgatg gccgctaacc agagccagct gtccaactgg gacacgtgca gttccaggta ccctgtgagc ctgtcgtcgg acctggagtg gcggcctgac cggtgccagg acgccagcga ggtacagcgc gacccgcgcg cgggttcggc gccactggct gaggacgtgc aggtggaccc gcgcaaggac tcgcacagca gctccgagcg cttcctagag cagtcgcact cgtccatgga gcgcgccttc gaggccgact acgggcgctc ctgcgactac aaggtggggt cgccgtccta cctggacaag ctgctgtggc gcgacaacaa gccgcaccac tactcggagc ccaagctcat cctggacctg tcgcactgga agcaggcggc cggcgcgccc cccacggcca cggggctggc ggacacgggg gcgcgcgagg acgagccggc cagcctcttc ctggagatcg cgcagtgggt caagagcacg cagggcggcc cagagcacgc cagcccgccc gccgacgacc ccgagcgccg cttgtctgcc tcgccccccg gccgcccggc cccggtggac ggcggcgcca gcccccagtt cgacctggac gtgttcatct cccgcgccct gaagctctgc accaagcccg aggacctgcc ggacaataaa ctgggcgacc tcaatggtgc gtgcatcccc gagcaccctg gcgacctcgt gcagaccgag gccttctcca aagaaaggtg gtga. It is sometimes possible for the material contained within the vial of "MAPK4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.