Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MAPK1IP1L cdna clone

MAPK1IP1L cDNA Clone

Gene Names
MAPK1IP1L; MISS; C14orf32; c14_5346
Synonyms
MAPK1IP1L; MAPK1IP1L cDNA Clone; MAPK1IP1L cdna clone
Ordering
For Research Use Only!
Sequence
atgtctgatgaattttcgttggcagatgcactacctgaacactcccctgccaaaacctctgctgtgagcaatacaaaacctggccaacctcctcaaggctggccaggctccaacccttggaataatccgagtgctccatcttcagtgccatctggactcccaccaagtgcaacaccctccactgtgccttttggaccagcaccaacaggaatgtatccctccgtgcctcccaccggaccacctccaggacccccagcaccctttcctccttccggaccatcatgtcccccacctggtggtccttatccagccccaactgtgccgggccctggccccacagggccatatcctacaccaaatatgccctttccagagctacccagaccatatggtgcacccacagatccagctgcagctggtcctttaggtccatggggatccatgtcttctggaccttgggcgccaggaatgggagggcagtatcctacccctaatatgccatatccatctccaggcccatatcccgctcctcctcctccccaggcccctggggcagcaccacctgttccatggggcaccgttccaccaggagcctggggaccaccagcaccatatcctgcccctacaggatcgtatcccacaccaggactctatcctactcccagtaatcctttccaagtgccttcaggaccttctggtgctccaccaatgcctggtggcccccattcttaccattaa
Sequence Length
738
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
24,269 Da
NCBI Official Full Name
Homo sapiens mitogen-activated protein kinase 1 interacting protein 1-like, mRNA
NCBI Official Synonym Full Names
mitogen-activated protein kinase 1 interacting protein 1 like
NCBI Official Symbol
MAPK1IP1L
NCBI Official Synonym Symbols
MISS; C14orf32; c14_5346
NCBI Protein Information
MAPK-interacting and spindle-stabilizing protein-like
UniProt Protein Name
MAPK-interacting and spindle-stabilizing protein-like
UniProt Gene Name
MAPK1IP1L
UniProt Synonym Gene Names
C14orf32
UniProt Entry Name
MISSL_HUMAN

Uniprot Description

MISS: Belongs to the MISS family.

Protein type: Cell cycle regulation

Chromosomal Location of Human Ortholog: 14q22.3

Molecular Function: protein binding

Similar Products

Product Notes

The MAPK1IP1L mapk1ip1l (Catalog #AAA1274055) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctgatg aattttcgtt ggcagatgca ctacctgaac actcccctgc caaaacctct gctgtgagca atacaaaacc tggccaacct cctcaaggct ggccaggctc caacccttgg aataatccga gtgctccatc ttcagtgcca tctggactcc caccaagtgc aacaccctcc actgtgcctt ttggaccagc accaacagga atgtatccct ccgtgcctcc caccggacca cctccaggac ccccagcacc ctttcctcct tccggaccat catgtccccc acctggtggt ccttatccag ccccaactgt gccgggccct ggccccacag ggccatatcc tacaccaaat atgccctttc cagagctacc cagaccatat ggtgcaccca cagatccagc tgcagctggt cctttaggtc catggggatc catgtcttct ggaccttggg cgccaggaat gggagggcag tatcctaccc ctaatatgcc atatccatct ccaggcccat atcccgctcc tcctcctccc caggcccctg gggcagcacc acctgttcca tggggcaccg ttccaccagg agcctgggga ccaccagcac catatcctgc ccctacagga tcgtatccca caccaggact ctatcctact cccagtaatc ctttccaagt gccttcagga ccttctggtg ctccaccaat gcctggtggc ccccattctt accattaa. It is sometimes possible for the material contained within the vial of "MAPK1IP1L, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.