Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MAP4K3 cdna clone

MAP4K3 cDNA Clone

Gene Names
MAP4K3; GLK; MEKKK3; MEKKK 3; MAPKKKK3; RAB8IPL1
Synonyms
MAP4K3; MAP4K3 cDNA Clone; MAP4K3 cdna clone
Ordering
For Research Use Only!
Sequence
atgaaccccggcttcgatttgtcccgccggaacccgcaggaggacttcgagctgattcagcgcatcggcagcggcacctacggcgacgtctacaaggcacggaatgttaacactggtgaattagcagcaattaaagtaataaaattggaaccaggagaagactttgcagttgtgcagcaagaaattatcatgatgaaagactgtaaacacccaaatattgttgcttattttggaagctatctcaggcgagataagctttggatttgcatggagttttgtggaggtggttctttacaggatatttatcacgtaactggacctctgtcagaactgcaaattgcatatgttagcagagaaacactgcagggattatattatcttcacagtaaaggaaaaatgcacagagatataaagggagctaacattctattaacggataatggtcatgtgaaattggctgattttggagtatctgcacagataacagctacaattgccaaacggaagtctttcattggcacaccatattggatggctccagaagttgcagctgttgagaggaaggggggttacaatcaactctgtgatctctgggcagtgggaatcactgccatagaacttgcagagcttcagcctcctatgtttgacttacacccaatgagagcattatttctaatgacaaaaagcaattttcagcctcctaaactaaaggataaaatgaaatggtcaaatagttttcatcactttgtgaaaatggcacttaccaaaaatccgaaaaaaagacctactgctgaaaaattattacagcatccttttgtaacacaacatttgacacggtctttggcaatcgagctgttggataaagtaaataatccagatcattccacttaccatgatttcgatgatgatgatcctgagcctcttgttgctgtaccacatagaattcactcaacaagtagaaacgtgagagaagaaaaaacacgctcagagataacctttggccaagtgaaatttgatccacccttaagaaaggagacagaaccacatcatgaacttgatctgcaactggaatatggacaaggacaccaaggtggttactttttaggtgcaaacaagagtcttctcaagtctgttgaagaagaattgcatcagcgaggacacgtcgcacatttagaagatgatgaaggagatgatgatgaatctaaacactcaactctgaaagcaaaaattccacctcctttgccaccaaagcctaagtctatcttcataccacaggaaatgcattctactgaggatgaaaatcaaggaacaatcaagagatgtcccatgtcagggagcccagcaaagccatcccaagttccacctagaccaccacctcccagattacccccacacaaacctgttgccttaggaaatggaatgagctccttccagttaaatggtgaacgagatggctcattatgtcaacaacagaatgaacatagaggcacaaacctttcaagaaaagaaaagaaagatgtaccaaagcctattagtaatggtcttcctccaacacctaaagtgcatatgggtgcatgtttttcaaaagtttttaatgggtgtcccttgaaaattcactgtgcatcatcatggataaacccagatactagagatcagtacttgatatttggtgccgaagaagggatttataccctcaatcttaatgaacttcatgaaacatcaatggaacagctattccctcgaaggtgtacatggttgtatgtaatgaacaattgcttgctatcaatatctggtaaagcttctcagctttattcccataatttaccagggctttttgattatgcaagacaaatgcaaaagttacctgttgctattccagcacacaaactccctgacagaatactgccaaggaaattttctgtatcagcaaaaatccctgaaaccaaatggtgccagaagtgttgtgttgtaagaaatccttacacgggccataaatacctatgtggagcacttcagactagcattgttctattagaatgggttgaaccaatgcagaaatttatgttaattaagcacatagattttcctataccatgtccacttagaatgtttgaaatgctggtagttcctgaacaggagtaccctttagtttgtgttggtgtcagtagaggtagagacttcaaccaagtggttcgatttgagacggtcaatccaaattctacctcttcatggtttacagaatcagataccccacagacaaatgttactcatgtaacccaactggagagagataccatccttgtatgcttggactgttgtataaaaatagtaaatctccaaggaagattaaaatctagcaggaaattgtcatcagaactcacctttgatttccagattgaatcaatagtgtgcctacaagacagtgtgctagctttctggaaacatggaatgcaaggtagaagttttagatctaatgaggtaacacaagaaatttcagatagcacaagaattttcaggctgcttggatctgacagggtcgtggttttggaaagtaggccaactgataaccccacagcaaatagcaatttgtacatcctggcgggtcatgaaaacagttactga
Sequence Length
2622
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
98,954 Da
NCBI Official Full Name
Homo sapiens mitogen-activated protein kinase kinase kinase kinase 3, mRNA
NCBI Official Synonym Full Names
mitogen-activated protein kinase kinase kinase kinase 3
NCBI Official Symbol
MAP4K3
NCBI Official Synonym Symbols
GLK; MEKKK3; MEKKK 3; MAPKKKK3; RAB8IPL1
NCBI Protein Information
mitogen-activated protein kinase kinase kinase kinase 3
UniProt Protein Name
Mitogen-activated protein kinase kinase kinase kinase 3
UniProt Gene Name
MAP4K3
UniProt Synonym Gene Names
RAB8IPL1; GLK; MEK kinase kinase 3; MEKKK 3
UniProt Entry Name
M4K3_HUMAN

NCBI Description

This gene encodes a member of the mitogen-activated protein kinase kinase kinase kinase family. The encoded protein activates key effectors in cell signalling, among them c-Jun. Alternatively spliced transcripts encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]

Uniprot Description

KHS2: an ubiquitous protein kinase of the STE20 family. May play a role in the response to environmental stress. Regulated by amino acids and acts upstream of mTORC1 and JNK. Required for maximal S6K and 4E-BP1 phosphorylation. Interacts with PPP2R5E, a regulatory subunit of PP2A. Following amino acid withdrawal, pS170 is dephosphorylated via PP2A. The dephosphorylation of pS170 by PP2A in response to amino acid restriction inhibits mTORC1 signaling. The inhibition of PPP2R5E expression prevents the dephosphorylation of KHS2 pS170, impairing mTORC1 inhibition during amino acid withdrawal. Three alternatively spliced isoforms have been described.

Protein type: Protein kinase, STE; Kinase, protein; Protein kinase, Ser/Thr (non-receptor); EC 2.7.11.1; STE group; STE20 family; KHS subfamily

Chromosomal Location of Human Ortholog: 2p22.1

Cellular Component: cytoplasm

Molecular Function: ATP binding; protein binding; protein kinase activity; protein serine/threonine kinase activity; receptor signaling protein serine/threonine kinase activity

Biological Process: JNK cascade; protein amino acid phosphorylation; response to UV

Research Articles on MAP4K3

Similar Products

Product Notes

The MAP4K3 map4k3 (Catalog #AAA1271376) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaccccg gcttcgattt gtcccgccgg aacccgcagg aggacttcga gctgattcag cgcatcggca gcggcaccta cggcgacgtc tacaaggcac ggaatgttaa cactggtgaa ttagcagcaa ttaaagtaat aaaattggaa ccaggagaag actttgcagt tgtgcagcaa gaaattatca tgatgaaaga ctgtaaacac ccaaatattg ttgcttattt tggaagctat ctcaggcgag ataagctttg gatttgcatg gagttttgtg gaggtggttc tttacaggat atttatcacg taactggacc tctgtcagaa ctgcaaattg catatgttag cagagaaaca ctgcagggat tatattatct tcacagtaaa ggaaaaatgc acagagatat aaagggagct aacattctat taacggataa tggtcatgtg aaattggctg attttggagt atctgcacag ataacagcta caattgccaa acggaagtct ttcattggca caccatattg gatggctcca gaagttgcag ctgttgagag gaaggggggt tacaatcaac tctgtgatct ctgggcagtg ggaatcactg ccatagaact tgcagagctt cagcctccta tgtttgactt acacccaatg agagcattat ttctaatgac aaaaagcaat tttcagcctc ctaaactaaa ggataaaatg aaatggtcaa atagttttca tcactttgtg aaaatggcac ttaccaaaaa tccgaaaaaa agacctactg ctgaaaaatt attacagcat ccttttgtaa cacaacattt gacacggtct ttggcaatcg agctgttgga taaagtaaat aatccagatc attccactta ccatgatttc gatgatgatg atcctgagcc tcttgttgct gtaccacata gaattcactc aacaagtaga aacgtgagag aagaaaaaac acgctcagag ataacctttg gccaagtgaa atttgatcca cccttaagaa aggagacaga accacatcat gaacttgatc tgcaactgga atatggacaa ggacaccaag gtggttactt tttaggtgca aacaagagtc ttctcaagtc tgttgaagaa gaattgcatc agcgaggaca cgtcgcacat ttagaagatg atgaaggaga tgatgatgaa tctaaacact caactctgaa agcaaaaatt ccacctcctt tgccaccaaa gcctaagtct atcttcatac cacaggaaat gcattctact gaggatgaaa atcaaggaac aatcaagaga tgtcccatgt cagggagccc agcaaagcca tcccaagttc cacctagacc accacctccc agattacccc cacacaaacc tgttgcctta ggaaatggaa tgagctcctt ccagttaaat ggtgaacgag atggctcatt atgtcaacaa cagaatgaac atagaggcac aaacctttca agaaaagaaa agaaagatgt accaaagcct attagtaatg gtcttcctcc aacacctaaa gtgcatatgg gtgcatgttt ttcaaaagtt tttaatgggt gtcccttgaa aattcactgt gcatcatcat ggataaaccc agatactaga gatcagtact tgatatttgg tgccgaagaa gggatttata ccctcaatct taatgaactt catgaaacat caatggaaca gctattccct cgaaggtgta catggttgta tgtaatgaac aattgcttgc tatcaatatc tggtaaagct tctcagcttt attcccataa tttaccaggg ctttttgatt atgcaagaca aatgcaaaag ttacctgttg ctattccagc acacaaactc cctgacagaa tactgccaag gaaattttct gtatcagcaa aaatccctga aaccaaatgg tgccagaagt gttgtgttgt aagaaatcct tacacgggcc ataaatacct atgtggagca cttcagacta gcattgttct attagaatgg gttgaaccaa tgcagaaatt tatgttaatt aagcacatag attttcctat accatgtcca cttagaatgt ttgaaatgct ggtagttcct gaacaggagt accctttagt ttgtgttggt gtcagtagag gtagagactt caaccaagtg gttcgatttg agacggtcaa tccaaattct acctcttcat ggtttacaga atcagatacc ccacagacaa atgttactca tgtaacccaa ctggagagag ataccatcct tgtatgcttg gactgttgta taaaaatagt aaatctccaa ggaagattaa aatctagcag gaaattgtca tcagaactca cctttgattt ccagattgaa tcaatagtgt gcctacaaga cagtgtgcta gctttctgga aacatggaat gcaaggtaga agttttagat ctaatgaggt aacacaagaa atttcagata gcacaagaat tttcaggctg cttggatctg acagggtcgt ggttttggaa agtaggccaa ctgataaccc cacagcaaat agcaatttgt acatcctggc gggtcatgaa aacagttact ga. It is sometimes possible for the material contained within the vial of "MAP4K3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.