Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MAP1LC3A cdna clone

MAP1LC3A cDNA Clone

Gene Names
MAP1LC3A; LC3; LC3A; ATG8E; MAP1ALC3; MAP1BLC3
Synonyms
MAP1LC3A; MAP1LC3A cDNA Clone; MAP1LC3A cdna clone
Ordering
For Research Use Only!
Sequence
atgccctcagaccggcctttcaagcagcggcggagcttcgccgaccgctgtaaggaggtacagcagatccgcgaccagcaccccagcaaaatcccggtgatcatcgagcgctacaagggtgagaagcagctgcccgtcctggacaagaccaagtttttggtcccggaccatgtcaacatgagcgagttggtcaagatcatccggcgccgcctgcagctgaaccccacgcaggccttcttcctgctggtgaaccagcacagcatggtgagtgtgtccacgcccatcgcggacatctacgagcaggagaaagacgaggacggcttcctctatatggtctacgcctcccaggaaaccttcggcttctga
Sequence Length
366
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
14,493 Da
NCBI Official Full Name
Homo sapiens microtubule-associated protein 1 light chain 3 alpha, mRNA
NCBI Official Synonym Full Names
microtubule associated protein 1 light chain 3 alpha
NCBI Official Symbol
MAP1LC3A
NCBI Official Synonym Symbols
LC3; LC3A; ATG8E; MAP1ALC3; MAP1BLC3
NCBI Protein Information
microtubule-associated proteins 1A/1B light chain 3A
UniProt Protein Name
Microtubule-associated proteins 1A/1B light chain 3A
UniProt Gene Name
MAP1LC3A
UniProt Synonym Gene Names
MAP1A/MAP1B LC3 A
UniProt Entry Name
MLP3A_HUMAN

NCBI Description

MAP1A and MAP1B are microtubule-associated proteins which mediate the physical interactions between microtubules and components of the cytoskeleton. MAP1A and MAP1B each consist of a heavy chain subunit and multiple light chain subunits. The protein encoded by this gene is one of the light chain subunits and can associate with either MAP1A or MAP1B. Two transcript variants encoding different isoforms have been found for this gene. The expression of variant 1 is suppressed in many tumor cell lines, suggesting that may be involved in carcinogenesis. [provided by RefSeq, Feb 2012]

Uniprot Description

LC3A: is a ubiquitin-like protein that is a constituent of the ATG8-conjugation system, one of two evolutionarily conserved phosphatidylethanolamine conjugation systems necessary for the formation of the autophagosome. The human ATG8 system includes seven ubiquitin-like light chain proteins (LCPs) that are homologs of yeast LC3: MAP1LC3A, -B, -C, GABARAP, GABARAPL1, -2, and -3. Pro-LCPs are cleaved by ATG4B to expose a C-terminal glycine residue, the cytosolic LCP-I form. The exposed C-terminus is conjugated to the head group amine of phosphatidylethanolamine (PE) through an amide bond by a sequence of ubiquitination-like reactions that involves an E1 (ATG7), an E2 (ATG3), and an E3 (a complex including ATG5, ATG12, and ATG16L). The PE-congugated form (LCP-II) is tightly associated with the autophagosomal membrane. The LCP-II forms can also be delipidated by the ATG4 proteases: most of the LCPs are delipidated and liberated from the membrane before autophagosomes fuse with lysosomes. Two isoforms of the human protein are produced by alternative splicing.

Protein type: Vesicle; Autophagy; Ubiquitin-like modifier; Microtubule-binding

Chromosomal Location of Human Ortholog: 20q11.22

Cellular Component: autophagic vacuole; cytosol

Molecular Function: microtubule binding; phosphatidylethanolamine binding; phospholipid binding; protein binding; ubiquitin protein ligase binding

Biological Process: autophagic vacuole formation; cellular response to nitrogen starvation; macroautophagy; mitochondrion degradation

Research Articles on MAP1LC3A

Similar Products

Product Notes

The MAP1LC3A map1lc3a (Catalog #AAA1267099) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccctcag accggccttt caagcagcgg cggagcttcg ccgaccgctg taaggaggta cagcagatcc gcgaccagca ccccagcaaa atcccggtga tcatcgagcg ctacaagggt gagaagcagc tgcccgtcct ggacaagacc aagtttttgg tcccggacca tgtcaacatg agcgagttgg tcaagatcat ccggcgccgc ctgcagctga accccacgca ggccttcttc ctgctggtga accagcacag catggtgagt gtgtccacgc ccatcgcgga catctacgag caggagaaag acgaggacgg cttcctctat atggtctacg cctcccagga aaccttcggc ttctga. It is sometimes possible for the material contained within the vial of "MAP1LC3A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.