Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MALT1 cdna clone

MALT1 cDNA Clone

Gene Names
MALT1; MLT; MLT1; IMD12; PCASP1
Synonyms
MALT1; MALT1 cDNA Clone; MALT1 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcgctgttgggggacccgctacaggccctgccgccctcggccgcccccacggggccgctgctcgcccctccggccggcgcgaccctcaaccgcctgcgggagccgctgctgcggaggctcagcgagctcctggatcaggcgcccgagggccggggctggaggagactggcggagctggcggggagtcgcgggcgcctccgcctcagttgcctagacctggagcagtgttctcttaaggtactggagcctgaaggaagccccagcctgtgtctgctgaagttaatgggtgaaaaaggttgcacagtcacagaattgagtgatttcctgcaggctatggaacacactgaagttcttcagcttctcagccccccaggaataaagattactgtaaacccagagtcaaaggcagtcttggctggacagtttgtgaaactgtgttgccgggcaactggacatccttttgttcaatatcagtggttcaaaatgaataaagagattccaaatggaaatacatcagagcttatttttaatgcagtgcatgtaaaagatgcaggcttttatgtctgtcgagttaataacaatttcacctttgaattcagccagtggtcacagctggatgtttgcgacatcccagagagcttccagagaagtgttgatggcgtctctgaatccaagttgcaaatctgtgttgaaccaacttcccaaaagctgatgccaggcagcacattggttttacagtgtgttgctgttggaagccctattcctcactaccagtggttcaaaaatgaattaccattaacacatgagaccaaaaagctatacatggtgccttatgtggatttggaacaccaaggaacctactggtgtcatgtatataatgatcgagacagtcaagatagcaagaaggtagaaatcatcatagatgaattaaataatcttggtcatcctgataataaagagcaaacaactgaccagcctttggcgaaggacaaggttgcccttttgataggaaatatgaattaccgggagcaccccaagctcaaagctcctttggtggatgtgtacgaattgactaacttactgagacagctggacttcaaagtggtttcactgttggatcttactgaatatgagatgcgtaatgctgtggatgagtttttactccttttagacaagggagtatatgggttattatattatgcaggacatggttatgaaaattttgggaacagcttcatggtccccgttgatgctccaaatccatataggtctgaaaattgtctgtgtgtacaaaatatactgaaattgatgcaagaaaaagaaactggacttaatgtgttcttattggatatgtgtaggaaaagaaatgactacgatgataccattccaatcttggatgcactaaaagtcaccgccaatattgtgtttggatatgccacgtgtcaaggagcagaagcttttgaaatccagcattctggattggcaaatggaatctttatgaaatttttaaaagacagattattagaagataagaaaatcactgtgttactggatgaagttgcagaagatatgggtaagtgtcaccttaccaaaggcaaacaggctctagagattcgaagtagtttatctgagaagagagcacttactgatccaatacagggaacagaatattctgctgaatctcttgtgcggaatctacagtgggccaaggctcatgaacttccagaaagtatgtgtcttaagtttgactgtggtgttcagattcaattaggatttgcagctgagttttccaatgtcatgatcatctatacaagtatagtttacaaaccaccggagataataatgtgtgatgcctacgttactgattttccacttgatctagatattgatccaaaagatgcaaataaaggcacacctgaagaaactggcagctacttggtatcaaaggatcttcccaagcattgcctctataccagactcagttcactgcaaaaattaaaggaacatctagtcttcacagtatgtttatcatatcagtactcaggattggaagatactgtagaggacaagcaggaagtgaatgttgggaaacctctcattgctaaattagacatgcatcgaggtttgggaaggaagacttgctttcaaacttgtcttatgtctaatggtccttaccagagttctgcagccacctcaggaggagcagggcattatcactcattgcaagacccattccatggtgtttaccattcacatcctggtaatccaagtaatgttacaccagcagatagctgtcattgcagccggactccagatgcatttatttcaagtttcgctcaccatgcttcatgtcattttagtagaagtaatgtgccagtagagacaactgatgaaataccatttagtttctctgacaggctcagaatttctgaaaaatga
Sequence Length
2442
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
91,081 Da
NCBI Official Full Name
Homo sapiens mucosa associated lymphoid tissue lymphoma translocation gene 1, mRNA
NCBI Official Synonym Full Names
MALT1 paracaspase
NCBI Official Symbol
MALT1
NCBI Official Synonym Symbols
MLT; MLT1; IMD12; PCASP1
NCBI Protein Information
mucosa-associated lymphoid tissue lymphoma translocation protein 1
UniProt Protein Name
Mucosa-associated lymphoid tissue lymphoma translocation protein 1
UniProt Gene Name
MALT1
UniProt Synonym Gene Names
MLT
UniProt Entry Name
MALT1_HUMAN

NCBI Description

This gene has been found to be recurrently rearranged in chromosomal translocation with two other genes - baculoviral IAP repeat-containing protein 3 (also known as apoptosis inhibitor 2) and immunoglobulin heavy chain locus - in mucosa-associated lymphoid tissue lymphomas. The protein encoded by this gene may play a role in NF-kappaB activation. Two alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

MALT1: Enhances BCL10-induced activation of NF-kappa-B. Involved in nuclear export of BCL10. Binds to TRAF6, inducing TRAF6 oligomerization and activation of its ligase activity. Has ubiquitin ligase activity. MALT1-dependent BCL10 cleavage plays an important role in T-cell antigen receptor-induced integrin adhesion. Binds through its Ig-like domains to BCL10. Forms oligomers which bind to TRAF6. Highly expressed in peripheral blood mononuclear cells. Detected at lower levels in bone marrow, thymus and lymph node, and at very low levels in colon and lung. Belongs to the peptidase C14B family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Ubiquitin conjugating system; Protease; Ligase; EC 3.4.22.-; Nuclear export; Apoptosis; Adaptor/scaffold

Chromosomal Location of Human Ortholog: 18q21

Cellular Component: cytoplasm; cytosol; nucleolus; nucleus; plasma membrane; protein complex

Molecular Function: kinase activator activity; peptidase activity; protein binding; protein self-association; signal transducer activity; ubiquitin-protein ligase activity

Biological Process: activation of NF-kappaB transcription factor; activation of NF-kappaB-inducing kinase; nuclear export; positive regulation of I-kappaB kinase/NF-kappaB cascade; positive regulation of interleukin-2 production; positive regulation of T cell activation; positive regulation of T cell cytokine production; protein oligomerization; proteolysis; regulation of apoptosis; stimulatory C-type lectin receptor signaling pathway; T cell receptor signaling pathway

Disease: Immunodeficiency 12

Research Articles on MALT1

Similar Products

Product Notes

The MALT1 malt1 (Catalog #AAA1266055) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcgctgt tgggggaccc gctacaggcc ctgccgccct cggccgcccc cacggggccg ctgctcgccc ctccggccgg cgcgaccctc aaccgcctgc gggagccgct gctgcggagg ctcagcgagc tcctggatca ggcgcccgag ggccggggct ggaggagact ggcggagctg gcggggagtc gcgggcgcct ccgcctcagt tgcctagacc tggagcagtg ttctcttaag gtactggagc ctgaaggaag ccccagcctg tgtctgctga agttaatggg tgaaaaaggt tgcacagtca cagaattgag tgatttcctg caggctatgg aacacactga agttcttcag cttctcagcc ccccaggaat aaagattact gtaaacccag agtcaaaggc agtcttggct ggacagtttg tgaaactgtg ttgccgggca actggacatc cttttgttca atatcagtgg ttcaaaatga ataaagagat tccaaatgga aatacatcag agcttatttt taatgcagtg catgtaaaag atgcaggctt ttatgtctgt cgagttaata acaatttcac ctttgaattc agccagtggt cacagctgga tgtttgcgac atcccagaga gcttccagag aagtgttgat ggcgtctctg aatccaagtt gcaaatctgt gttgaaccaa cttcccaaaa gctgatgcca ggcagcacat tggttttaca gtgtgttgct gttggaagcc ctattcctca ctaccagtgg ttcaaaaatg aattaccatt aacacatgag accaaaaagc tatacatggt gccttatgtg gatttggaac accaaggaac ctactggtgt catgtatata atgatcgaga cagtcaagat agcaagaagg tagaaatcat catagatgaa ttaaataatc ttggtcatcc tgataataaa gagcaaacaa ctgaccagcc tttggcgaag gacaaggttg cccttttgat aggaaatatg aattaccggg agcaccccaa gctcaaagct cctttggtgg atgtgtacga attgactaac ttactgagac agctggactt caaagtggtt tcactgttgg atcttactga atatgagatg cgtaatgctg tggatgagtt tttactcctt ttagacaagg gagtatatgg gttattatat tatgcaggac atggttatga aaattttggg aacagcttca tggtccccgt tgatgctcca aatccatata ggtctgaaaa ttgtctgtgt gtacaaaata tactgaaatt gatgcaagaa aaagaaactg gacttaatgt gttcttattg gatatgtgta ggaaaagaaa tgactacgat gataccattc caatcttgga tgcactaaaa gtcaccgcca atattgtgtt tggatatgcc acgtgtcaag gagcagaagc ttttgaaatc cagcattctg gattggcaaa tggaatcttt atgaaatttt taaaagacag attattagaa gataagaaaa tcactgtgtt actggatgaa gttgcagaag atatgggtaa gtgtcacctt accaaaggca aacaggctct agagattcga agtagtttat ctgagaagag agcacttact gatccaatac agggaacaga atattctgct gaatctcttg tgcggaatct acagtgggcc aaggctcatg aacttccaga aagtatgtgt cttaagtttg actgtggtgt tcagattcaa ttaggatttg cagctgagtt ttccaatgtc atgatcatct atacaagtat agtttacaaa ccaccggaga taataatgtg tgatgcctac gttactgatt ttccacttga tctagatatt gatccaaaag atgcaaataa aggcacacct gaagaaactg gcagctactt ggtatcaaag gatcttccca agcattgcct ctataccaga ctcagttcac tgcaaaaatt aaaggaacat ctagtcttca cagtatgttt atcatatcag tactcaggat tggaagatac tgtagaggac aagcaggaag tgaatgttgg gaaacctctc attgctaaat tagacatgca tcgaggtttg ggaaggaaga cttgctttca aacttgtctt atgtctaatg gtccttacca gagttctgca gccacctcag gaggagcagg gcattatcac tcattgcaag acccattcca tggtgtttac cattcacatc ctggtaatcc aagtaatgtt acaccagcag atagctgtca ttgcagccgg actccagatg catttatttc aagtttcgct caccatgctt catgtcattt tagtagaagt aatgtgccag tagagacaac tgatgaaata ccatttagtt tctctgacag gctcagaatt tctgaaaaat ga. It is sometimes possible for the material contained within the vial of "MALT1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.