Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MAGEB1 cdna clone

MAGEB1 cDNA Clone

Gene Names
MAGEB1; CT3.1; DAM10; MAGEL1; MAGE-Xp
Synonyms
MAGEB1; MAGEB1 cDNA Clone; MAGEB1 cdna clone
Ordering
For Research Use Only!
Sequence
atgcctcggggtcagaagagtaagctccgtgctcgtgagaaacgccgcaaggcgcgagaggagacccactatctcaaggttgctcacgccactgcagcagagaaagaggagtgcccctcctcctctcctgttttaggggatactcccacaagctcccctgctgctggcattccccagaagcctcagggagctccacccaccaccactgctgctgcagctgtgtcatgtaccgaatctgacgaaggtgccaaatgccaaggtgaggaaaatgcaagtttctcccaggccacaacatccactgagagctcagtcaaagatcctgtagcctgggaggcaggaatgctgatgcacttcattctacgtaagtataaaatgagagagcccattatgaaggcagatatgctgaaggttgttgatgaaaagtacaaggagtacttcactgagatcctcaatggagcctctcgccgcttggagctcgtctttggccttgatttgaaggaagacaaccctagtggccacacctacaccctcgtcagtaagctaaacctcaccaatgatggaaacctgagcaatgattgggactttcccaggaatgggcttctgatgcctctcctgggtgtgatcttcttaaagggcaactctgccaccgaggaagagatctggaaattcatgaatgtgttgggagcctatgatggagaggagcacttaatctatggggaaccccgtaagttcatcacccaagatctggtgcaggaaaaatatctgaagtacgagcaggtgcccaacagtgatcccccacgctatcaattcctatggggtccgagagcctatgctgaaaccaccaagatgaaagtcctcgagtttttggccaagatgaatggtgccactccccgtgacttcccatcccattatgaagaggctttgagagatgaggaagagagagcccaagtccgatccagtgttagagccaggcgtcgcactactgccacgacttttagagcgcgttctagagccccattcagcaggtcctcccaccccatgtga
Sequence Length
1044
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
39,037 Da
NCBI Official Full Name
Homo sapiens melanoma antigen family B, 1, mRNA
NCBI Official Synonym Full Names
MAGE family member B1
NCBI Official Symbol
MAGEB1
NCBI Official Synonym Symbols
CT3.1; DAM10; MAGEL1; MAGE-Xp
NCBI Protein Information
melanoma-associated antigen B1
UniProt Protein Name
Melanoma-associated antigen B1
UniProt Gene Name
MAGEB1
UniProt Synonym Gene Names
MAGEL1; MAGEXP; CT3.1; DAM10
UniProt Entry Name
MAGB1_HUMAN

NCBI Description

This gene is a member of the MAGEB gene family. The members of this family have their entire coding sequences located in the last exon, and the encoded proteins show 50 to 68% sequence identity to each other. The promoters and first exons of the MAGEB genes show considerable variability, suggesting that the existence of this gene family enables the same function to be expressed under different transcriptional controls. This gene is localized in the DSS (dosage-sensitive sex reversal) critical region, and expressed in testis and in a significant fraction of tumors of various histological types. This gene and other MAGEB members are clustered on chromosome Xp22-p21. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene, however, the full length nature of some variants has not been defined. [provided by RefSeq, Jul 2008]

Uniprot Description

MAGE-B1:

Protein type: Cancer Testis Antigen (CTA)

Chromosomal Location of Human Ortholog: Xp21.3

Research Articles on MAGEB1

Similar Products

Product Notes

The MAGEB1 mageb1 (Catalog #AAA1266349) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcctcggg gtcagaagag taagctccgt gctcgtgaga aacgccgcaa ggcgcgagag gagacccact atctcaaggt tgctcacgcc actgcagcag agaaagagga gtgcccctcc tcctctcctg ttttagggga tactcccaca agctcccctg ctgctggcat tccccagaag cctcagggag ctccacccac caccactgct gctgcagctg tgtcatgtac cgaatctgac gaaggtgcca aatgccaagg tgaggaaaat gcaagtttct cccaggccac aacatccact gagagctcag tcaaagatcc tgtagcctgg gaggcaggaa tgctgatgca cttcattcta cgtaagtata aaatgagaga gcccattatg aaggcagata tgctgaaggt tgttgatgaa aagtacaagg agtacttcac tgagatcctc aatggagcct ctcgccgctt ggagctcgtc tttggccttg atttgaagga agacaaccct agtggccaca cctacaccct cgtcagtaag ctaaacctca ccaatgatgg aaacctgagc aatgattggg actttcccag gaatgggctt ctgatgcctc tcctgggtgt gatcttctta aagggcaact ctgccaccga ggaagagatc tggaaattca tgaatgtgtt gggagcctat gatggagagg agcacttaat ctatggggaa ccccgtaagt tcatcaccca agatctggtg caggaaaaat atctgaagta cgagcaggtg cccaacagtg atcccccacg ctatcaattc ctatggggtc cgagagccta tgctgaaacc accaagatga aagtcctcga gtttttggcc aagatgaatg gtgccactcc ccgtgacttc ccatcccatt atgaagaggc tttgagagat gaggaagaga gagcccaagt ccgatccagt gttagagcca ggcgtcgcac tactgccacg acttttagag cgcgttctag agccccattc agcaggtcct cccaccccat gtga. It is sometimes possible for the material contained within the vial of "MAGEB1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.