MAGEA9 cdna clone
MAGEA9 cDNA Clone
Gene Names
MAGEA9; CT1.9; MAGE9
Synonyms
MAGEA9; MAGEA9 cDNA Clone; MAGEA9 cdna clone
Sequence
atgtctctcgagcagaggagtccgcactgcaagcctgatgaagaccttgaagcccaaggagaggacttgggcctgatgggtgcacaggaacccacaggcgaggaggaggagactacctcctcctctgacagcaaggaggaggaggtgtctgctgctgggtcatcaagtcctccccagagtcctcagggaggcgcttcctcctccatttccgtctactacactttatggagccaattcgatgagggctccagcagtcaagaagaggaagagccaagctcctcggtcgacccagctcagctggagttcatgttccaagaagcactgaaattgaaggtggctgagttggttcatttcctgctccacaaatatcgagtcaaggagccggtcacaaaggcagaaatgctggagagcgtcatcaaaaattacaagcgctactttcctgtgatcttcggcaaagcctccgagttcatgcaggtgatctttggcactgatgtgaaggaggtggaccccgccggccactcctacatccttgtcactgctcttggcctctcgtgcgatagcatgctgggtgatggtcatagcatgcccaaggccgccctcctgatcattgtcctgggtgtgatcctaaccaaagacaactgcgcccctgaagaggttatctgggaagcgttgagtgtgatgggggtgtatgttgggaaggagcacatgttctacggggagcccaggaagctgctcacccaagattgggtgcaggaaaactacctggagtaccggcaggtgcccggcagtgatcctgcgcactacgagttcctgtggggttccaaggcccacgctgaaaccagctatgagaaggtcataaattatttggtcatgctcaatgcaagagagcccatctgctacccatccctttatgaagaggttttgggagaggagcaagagggagtctga
Sequence Length
948
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
35,088 Da
NCBI Official Full Name
Homo sapiens melanoma antigen family A, 9, mRNA
NCBI Official Synonym Full Names
MAGE family member A9
NCBI Official Symbol
MAGEA9
NCBI Official Synonym Symbols
CT1.9; MAGE9
NCBI Protein Information
melanoma-associated antigen 9
UniProt Protein Name
Melanoma-associated antigen 9
Protein Family
UniProt Gene Name
MAGEA9
UniProt Synonym Gene Names
MAGE9; MAGEA9A; CT1.9
UniProt Entry Name
MAGA9_HUMAN
NCBI Description
This gene is a member of the MAGEA gene family. The members of this family encode proteins with 50 to 80% sequence identity to each other. The promoters and first exons of the MAGEA genes show considerable variability, suggesting that the existence of this gene family enables the same function to be expressed under different transcriptional controls. The MAGEA genes are clustered at chromosomal location Xq28. They have been implicated in some hereditary disorders, such as dyskeratosis congenita. [provided by RefSeq, Jul 2008]
Uniprot Description
MAGE-A9: Not known, though may play a role in embryonal development and tumor transformation or aspects of tumor progression.
Protein type: Cancer Testis Antigen (CTA)
Chromosomal Location of Human Ortholog: Xq28
Molecular Function: protein binding
Research Articles on MAGEA9
Similar Products
Product Notes
The MAGEA9 magea9 (Catalog #AAA1274813) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctctcg agcagaggag tccgcactgc aagcctgatg aagaccttga agcccaagga gaggacttgg gcctgatggg tgcacaggaa cccacaggcg aggaggagga gactacctcc tcctctgaca gcaaggagga ggaggtgtct gctgctgggt catcaagtcc tccccagagt cctcagggag gcgcttcctc ctccatttcc gtctactaca ctttatggag ccaattcgat gagggctcca gcagtcaaga agaggaagag ccaagctcct cggtcgaccc agctcagctg gagttcatgt tccaagaagc actgaaattg aaggtggctg agttggttca tttcctgctc cacaaatatc gagtcaagga gccggtcaca aaggcagaaa tgctggagag cgtcatcaaa aattacaagc gctactttcc tgtgatcttc ggcaaagcct ccgagttcat gcaggtgatc tttggcactg atgtgaagga ggtggacccc gccggccact cctacatcct tgtcactgct cttggcctct cgtgcgatag catgctgggt gatggtcata gcatgcccaa ggccgccctc ctgatcattg tcctgggtgt gatcctaacc aaagacaact gcgcccctga agaggttatc tgggaagcgt tgagtgtgat gggggtgtat gttgggaagg agcacatgtt ctacggggag cccaggaagc tgctcaccca agattgggtg caggaaaact acctggagta ccggcaggtg cccggcagtg atcctgcgca ctacgagttc ctgtggggtt ccaaggccca cgctgaaacc agctatgaga aggtcataaa ttatttggtc atgctcaatg caagagagcc catctgctac ccatcccttt atgaagaggt tttgggagag gagcaagagg gagtctga. It is sometimes possible for the material contained within the vial of "MAGEA9, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
