Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MAGEA2 cdna clone

MAGEA2 cDNA Clone

Gene Names
MAGEA2B; CT1.2; MAGE2
Synonyms
MAGEA2; MAGEA2 cDNA Clone; MAGEA2 cdna clone
Ordering
For Research Use Only!
Sequence
atgcctcttgagcagaggagtcagcactgcaagcctgaagaaggccttgaggcccgaggagaggccctgggcctggtgggtgcgcaggctcctgctactgaggagcagcagaccgcttcttcctcttctactctagtggaagttaccctgggggaggtgcctgctgccgactcaccgagtcctccccacagtcctcagggagcctccagcttctcgactaccatcaactacactctttggagacaatccgatgagggctccagcaaccaagaagaggaggggccaagaatgtttcccgacctggagtccgagttccaagcagcaatcagtaggaagatggttgagttggttcattttctgctcctcaagtatcgagccagggagccggtcacaaaggcagaaatgctggagagtgtcctcagaaattgccaggacttctttcccgtgatcttcagcaaagcctccgagtacttgcagctggtctttggcattgaggtggtggaagtggtccccatcagccacttgtacatccttgtcacctgcctgggcctctcctacgatggcctgctgggcgacaatcaggtcatgcccaagacaggcctcctgataatcgtcctggccataatcgcaatagagggcgactgtgcccctgaggagaaaatctgggaggagctgagtatgttggaggtgtttgaggggagggaggacagtgtcttcgcacatcccaggaagctgctcacccaagatttggtgcaggaaaactacctggagtaccggcaggtgcccggcagtgatcctgcatgctacgagttcctgtggggtccaagggccctcattgaaaccagctatgtgaaagtcctgcaccatacactaaagatcggtggagaacctcacatttcctacccacccctgcatgaacgggctttgagagagggagaagagtga
Sequence Length
945
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,055 Da
NCBI Official Full Name
Homo sapiens melanoma antigen family A, 2B, mRNA
NCBI Official Synonym Full Names
MAGE family member A2B
NCBI Official Symbol
MAGEA2B
NCBI Official Synonym Symbols
CT1.2; MAGE2
NCBI Protein Information
melanoma-associated antigen 2
UniProt Protein Name
Melanoma-associated antigen 2
UniProt Gene Name
MAGEA2
UniProt Synonym Gene Names
MAGE2; MAGEA2A; CT1.2
UniProt Entry Name
MAGA2_HUMAN

NCBI Description

This gene is a member of the MAGEA gene family. The members of this family encode proteins with 50 to 80% sequence identity to each other. The promoters and first exons of the MAGEA genes show considerable variability, suggesting that the existence of this gene family enables the same function to be expressed under different transcriptional controls. The MAGEA genes are clustered at chromosomal location Xq28. They have been implicated in some hereditary disorders, such as dyskeratosis congenita. This gene has two identical copies at different loci. [provided by RefSeq, Jul 2008]

Uniprot Description

MAGE-A2: Reduces p53/TP53 transactivation function through recruitment of HDAC3 to p53/TP53 transcription sites. Also represses p73/TP73 activity. Proposed to enhance ubiquitin ligase activity of RING-type zinc finger-containing E3 ubiquitin-protein ligases. In vitro enhances ubiquitin ligase activity of TRIM28 and stimulates p53/TP53 ubiquitination by TRIM28 potentially in presence of Ubl-conjugating enzyme UBE2H. Proposed to act through recruitment and/or stabilization of the Ubl-conjugating enzyme (E2) at the E3:substrate complex. May play a role in embryonal development and tumor transformation or aspects of tumor progression. In vitro promotes cell viability in melanoma cell lines. Antigen recognized on a melanoma by autologous cytolytic T- lymphocytes.

Protein type: Cancer Testis Antigen (CTA)

Chromosomal Location of Human Ortholog: Xq28

Cellular Component: nucleus; PML body

Molecular Function: histone deacetylase binding; protein binding; ubiquitin protein ligase binding

Biological Process: cellular protein catabolic process; negative regulation of protein sumoylation; negative regulation of transcription from RNA polymerase II promoter; positive regulation of ubiquitin-protein ligase activity

Similar Products

Product Notes

The MAGEA2 magea2 (Catalog #AAA1276934) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcctcttg agcagaggag tcagcactgc aagcctgaag aaggccttga ggcccgagga gaggccctgg gcctggtggg tgcgcaggct cctgctactg aggagcagca gaccgcttct tcctcttcta ctctagtgga agttaccctg ggggaggtgc ctgctgccga ctcaccgagt cctccccaca gtcctcaggg agcctccagc ttctcgacta ccatcaacta cactctttgg agacaatccg atgagggctc cagcaaccaa gaagaggagg ggccaagaat gtttcccgac ctggagtccg agttccaagc agcaatcagt aggaagatgg ttgagttggt tcattttctg ctcctcaagt atcgagccag ggagccggtc acaaaggcag aaatgctgga gagtgtcctc agaaattgcc aggacttctt tcccgtgatc ttcagcaaag cctccgagta cttgcagctg gtctttggca ttgaggtggt ggaagtggtc cccatcagcc acttgtacat ccttgtcacc tgcctgggcc tctcctacga tggcctgctg ggcgacaatc aggtcatgcc caagacaggc ctcctgataa tcgtcctggc cataatcgca atagagggcg actgtgcccc tgaggagaaa atctgggagg agctgagtat gttggaggtg tttgagggga gggaggacag tgtcttcgca catcccagga agctgctcac ccaagatttg gtgcaggaaa actacctgga gtaccggcag gtgcccggca gtgatcctgc atgctacgag ttcctgtggg gtccaagggc cctcattgaa accagctatg tgaaagtcct gcaccataca ctaaagatcg gtggagaacc tcacatttcc tacccacccc tgcatgaacg ggctttgaga gagggagaag agtga. It is sometimes possible for the material contained within the vial of "MAGEA2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.