Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LZTFL1 cdna clone

LZTFL1 cDNA Clone

Gene Names
LZTFL1; BBS17
Synonyms
LZTFL1; LZTFL1 cDNA Clone; LZTFL1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcagagttgggcctaaatgagcaccatcaaaatgaagttattaattatatgcgttttgctcgttcaaagagaggcttgagactcaaaactgtagattcctgcttccaagacctcaaggagagcaggctggtggaggacaccttcaccatagatgaagtctctgaagtcctcaatggattacaagctgtggttcatagtgaggtggaatctgagctcatcaacactgcctataccaatgtgttacttctgcgacagctgtttgcacaagctgagaagtggtatcttaagctacagacagacatctctgaacttgaaaaccaagaattattagaacaagttgcagaatttgaaaaagcagagattacatcttcaaacaaaaagcccatcttagatgtcacaaagccaaaacttgctccacttaatgaaggtggaacagcagaactcctaaacgaggaaattttaagacttcaagaagagaatgagaaattgaagtcaaggttgaagaccattgaaatacaggctacaaatgcactggatgaaaagtcaaaactagaaaaagcactgcaagatttacagcttgatcaaggaaatcaaaaggattttataaaggcccaagacttaagtaacttagaaaacactgtcgctgccttaaagagtgagtttcagaagacacttaatgacaagacagaaaaccagaagtcactggaggagaatctggcgacagccaagcacgatctactcagggttcgggagcagctgcacatggctgaaaaggaattagaaaagaaatttcagcaaacagcagcttatcgaaacatgaaagagattcttaccaagaagaatgaccaaatcaaagatctgaggaaaagactggcacaatatgaacctgaagattaa
Sequence Length
900
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
29,332 Da
NCBI Official Full Name
Homo sapiens leucine zipper transcription factor-like 1, mRNA
NCBI Official Synonym Full Names
leucine zipper transcription factor like 1
NCBI Official Symbol
LZTFL1
NCBI Official Synonym Symbols
BBS17
NCBI Protein Information
leucine zipper transcription factor-like protein 1
UniProt Protein Name
Leucine zipper transcription factor-like protein 1
UniProt Gene Name
LZTFL1
UniProt Entry Name
LZTL1_HUMAN

NCBI Description

This gene encodes a ubiquitously expressed protein that localizes to the cytoplasm. This protein interacts with Bardet-Biedl Syndrome (BBS) proteins and, through its interaction with BBS protein complexes, regulates protein trafficking to the ciliary membrane. Nonsense mutations in this gene cause a form of Bardet-Biedl Syndrome; a ciliopathy characterized in part by polydactyly, obesity, cognitive impairment, hypogonadism, and kidney failure. This gene may also function as a tumor suppressor; possibly by interacting with E-cadherin and the actin cytoskeleton and thereby regulating the transition of epithelial cells to mesenchymal cells. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2013]

Uniprot Description

LZTFL1: Belongs to the LZTFL1 family.

Chromosomal Location of Human Ortholog: 3p21.3

Cellular Component: cytosol

Molecular Function: identical protein binding; protein binding; protein complex binding

Disease: Bardet-biedl Syndrome 17

Research Articles on LZTFL1

Similar Products

Product Notes

The LZTFL1 lztfl1 (Catalog #AAA1268139) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagagt tgggcctaaa tgagcaccat caaaatgaag ttattaatta tatgcgtttt gctcgttcaa agagaggctt gagactcaaa actgtagatt cctgcttcca agacctcaag gagagcaggc tggtggagga caccttcacc atagatgaag tctctgaagt cctcaatgga ttacaagctg tggttcatag tgaggtggaa tctgagctca tcaacactgc ctataccaat gtgttacttc tgcgacagct gtttgcacaa gctgagaagt ggtatcttaa gctacagaca gacatctctg aacttgaaaa ccaagaatta ttagaacaag ttgcagaatt tgaaaaagca gagattacat cttcaaacaa aaagcccatc ttagatgtca caaagccaaa acttgctcca cttaatgaag gtggaacagc agaactccta aacgaggaaa ttttaagact tcaagaagag aatgagaaat tgaagtcaag gttgaagacc attgaaatac aggctacaaa tgcactggat gaaaagtcaa aactagaaaa agcactgcaa gatttacagc ttgatcaagg aaatcaaaag gattttataa aggcccaaga cttaagtaac ttagaaaaca ctgtcgctgc cttaaagagt gagtttcaga agacacttaa tgacaagaca gaaaaccaga agtcactgga ggagaatctg gcgacagcca agcacgatct actcagggtt cgggagcagc tgcacatggc tgaaaaggaa ttagaaaaga aatttcagca aacagcagct tatcgaaaca tgaaagagat tcttaccaag aagaatgacc aaatcaaaga tctgaggaaa agactggcac aatatgaacc tgaagattaa. It is sometimes possible for the material contained within the vial of "LZTFL1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.