Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LYVE1 cdna clone

LYVE1 cDNA Clone

Gene Names
LYVE1; HAR; XLKD1; LYVE-1; CRSBP-1
Synonyms
LYVE1; LYVE1 cDNA Clone; LYVE1 cdna clone
Ordering
For Research Use Only!
Sequence
atggccaggtgcttcagcctggtgttgcttctcacttccatctggaccacgaggctcctggtccaaggctctttgcgtgcagaagagctttccatccaggtgtcatgcagaattatggggatcacccttgtgagcaaaaaggcgaaccagcagctgaatttcacagaagctaaggaggcctgtaggctgctgggactaagtttggccggcaaggaccaagttgaaacagccttgaaagctagctttgaaacttgcagctatggctgggttggagatggattcgtggtcatctctaggattagcccaaaccccaagtgtgggaaaaatggggtgggtgtcctgattaggaaggttccagtgagccgacagtttgcagcctattgttacaactcatctgatacttggactaactcgtgcattccagaaattatcaccaccaaagatcccatattcaacactcaaactgcaacacaaacaacagaatttattgtcagtgacagtacctactcggtggcatccccttactctacaatacctgcccctactactactcctcctgctccagcttccacttctattccacggagaaaaaaattgatttgtgtcacagaagtttttatggaaactagcaccatgtctacagaaactgaaccatttgttgaaaataaagcagcattcaagaatgaagctgctgggtttggaggtgtccccacggctctgctagtgcttgctctcctcttctttggtgctgcagctggtcttggattttgctatgtcaaaaggtatgtgaaggccttcccttttacaaacaagaatcagcagaaggaaatgatcgaaaccaaagtagtaaaggaggagaaggccaatgatagcaaccctaatgaggaatcaaagaaaactgataaaaacccagaagagtccaagagtccaagcaaaactaccgtgcgatgcctggaagctgaagtttag
Sequence Length
969
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,213 Da
NCBI Official Full Name
Homo sapiens lymphatic vessel endothelial hyaluronan receptor 1, mRNA
NCBI Official Synonym Full Names
lymphatic vessel endothelial hyaluronan receptor 1
NCBI Official Symbol
LYVE1
NCBI Official Synonym Symbols
HAR; XLKD1; LYVE-1; CRSBP-1
NCBI Protein Information
lymphatic vessel endothelial hyaluronic acid receptor 1
UniProt Protein Name
Lymphatic vessel endothelial hyaluronic acid receptor 1
UniProt Gene Name
LYVE1
UniProt Synonym Gene Names
CRSBP1; HAR; XLKD1; LYVE-1; CRSBP-1
UniProt Entry Name
LYVE1_HUMAN

NCBI Description

This gene encodes a type I integral membrane glycoprotein. The encoded protein acts as a receptor and binds to both soluble and immobilized hyaluronan. This protein may function in lymphatic hyaluronan transport and have a role in tumor metastasis. [provided by RefSeq, Jul 2008]

Uniprot Description

XLKD1: Ligand-specific transporter trafficking between intracellular organelles (TGN) and the plasma membrane. Plays a role in autocrine regulation of cell growth mediated by growth regulators containing cell surface retention sequence binding (CRS). May act as an hyaluronan (HA) transporter, either mediating its uptake for catabolism within lymphatic endothelial cells themselves, or its transport into the lumen of afferent lymphatic vessels for subsequent re-uptake and degradation in lymph nodes.

Protein type: Membrane protein, integral; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 11p15

Cellular Component: integral to plasma membrane; membrane; plasma membrane

Molecular Function: protein binding; receptor activity

Biological Process: anatomical structure morphogenesis; cell motility; cell-matrix adhesion; hyaluronan catabolic process; response to wounding

Research Articles on LYVE1

Similar Products

Product Notes

The LYVE1 lyve1 (Catalog #AAA1270589) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccaggt gcttcagcct ggtgttgctt ctcacttcca tctggaccac gaggctcctg gtccaaggct ctttgcgtgc agaagagctt tccatccagg tgtcatgcag aattatgggg atcacccttg tgagcaaaaa ggcgaaccag cagctgaatt tcacagaagc taaggaggcc tgtaggctgc tgggactaag tttggccggc aaggaccaag ttgaaacagc cttgaaagct agctttgaaa cttgcagcta tggctgggtt ggagatggat tcgtggtcat ctctaggatt agcccaaacc ccaagtgtgg gaaaaatggg gtgggtgtcc tgattaggaa ggttccagtg agccgacagt ttgcagccta ttgttacaac tcatctgata cttggactaa ctcgtgcatt ccagaaatta tcaccaccaa agatcccata ttcaacactc aaactgcaac acaaacaaca gaatttattg tcagtgacag tacctactcg gtggcatccc cttactctac aatacctgcc cctactacta ctcctcctgc tccagcttcc acttctattc cacggagaaa aaaattgatt tgtgtcacag aagtttttat ggaaactagc accatgtcta cagaaactga accatttgtt gaaaataaag cagcattcaa gaatgaagct gctgggtttg gaggtgtccc cacggctctg ctagtgcttg ctctcctctt ctttggtgct gcagctggtc ttggattttg ctatgtcaaa aggtatgtga aggccttccc ttttacaaac aagaatcagc agaaggaaat gatcgaaacc aaagtagtaa aggaggagaa ggccaatgat agcaacccta atgaggaatc aaagaaaact gataaaaacc cagaagagtc caagagtcca agcaaaacta ccgtgcgatg cctggaagct gaagtttag. It is sometimes possible for the material contained within the vial of "LYVE1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.