Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LYPLA1 cdna clone

LYPLA1 cDNA Clone

Gene Names
LYPLA1; APT1; LPL1; APT-1; LPL-I; hAPT1
Synonyms
LYPLA1; LYPLA1 cDNA Clone; LYPLA1 cdna clone
Ordering
For Research Use Only!
Sequence
atgtgcggcaataacatgtcaaccccgctgcccgccatcgtgcccgccgcccggaaggccaccgctgcggtgattttcctgcatggattgggagatactgggcacggatgggcagaagcctttgcaggtatcagaagttcacatatcaaatatatctgcccgcatgcgcctgttaggcctgttacattaaatatgaacgtggctatgccttcatggtttgatattattgggctttcaccagattcacaggaggatgaatctgggattaaacaggcagcagaaaatataaaagctttgattgatcaagaagtgaagaatggcattccttctaacagaattattttgggagggttttctcagggaggagctttatctttatatactgcccttaccacacagcagaaactggcaggtgtcactgcactcagttgctggcttccacttcgggcttcctttccacagggtcctatcggtggtgctaatagagatatttctattctccagtgccacggggattgtgaccctttggttcccctgatgtttggttctcttacggtggaaaaactaaaaacattggtgaatccagccaatgtgacctttaaaacctatgaaggtatgatgcacagttcgtgtcaacaggaaatgatggatgtcaagcaattcattgataaactcctacctccaattgattga
Sequence Length
693
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
22,875 Da
NCBI Official Full Name
Homo sapiens lysophospholipase I, mRNA
NCBI Official Synonym Full Names
lysophospholipase I
NCBI Official Symbol
LYPLA1
NCBI Official Synonym Symbols
APT1; LPL1; APT-1; LPL-I; hAPT1
NCBI Protein Information
acyl-protein thioesterase 1
UniProt Protein Name
Acyl-protein thioesterase 1
UniProt Gene Name
LYPLA1
UniProt Synonym Gene Names
APT1; LPL1; APT-1; hAPT1; LPL-I; LysoPLA I
UniProt Entry Name
LYPA1_HUMAN

NCBI Description

This gene encodes a member of the alpha/beta hydrolase superfamily. The encoded protein functions as a homodimer, exhibiting both depalmitoylating as well as lysophospholipase activity, and may be involved in Ras localization and signaling. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene have been defined on chromosomes 4, 6, and 7. [provided by RefSeq, Jul 2013]

Uniprot Description

LYPLA1: Hydrolyzes fatty acids from S-acylated cysteine residues in proteins such as trimeric G alpha proteins or HRAS. Has depalmitoylating activity and also low lysophospholipase activity. Belongs to the AB hydrolase 2 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Lipid Metabolism - glycerophospholipid; EC 3.1.2.-; Mitochondrial; Phospholipase

Chromosomal Location of Human Ortholog: 8q11.23

Cellular Component: cytoplasm; cytosol

Molecular Function: lipase activity; lysophospholipase activity; palmitoyl-(protein) hydrolase activity

Biological Process: protein depalmitoylation; regulation of nitric-oxide synthase activity

Research Articles on LYPLA1

Similar Products

Product Notes

The LYPLA1 lypla1 (Catalog #AAA1272288) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtgcggca ataacatgtc aaccccgctg cccgccatcg tgcccgccgc ccggaaggcc accgctgcgg tgattttcct gcatggattg ggagatactg ggcacggatg ggcagaagcc tttgcaggta tcagaagttc acatatcaaa tatatctgcc cgcatgcgcc tgttaggcct gttacattaa atatgaacgt ggctatgcct tcatggtttg atattattgg gctttcacca gattcacagg aggatgaatc tgggattaaa caggcagcag aaaatataaa agctttgatt gatcaagaag tgaagaatgg cattccttct aacagaatta ttttgggagg gttttctcag ggaggagctt tatctttata tactgccctt accacacagc agaaactggc aggtgtcact gcactcagtt gctggcttcc acttcgggct tcctttccac agggtcctat cggtggtgct aatagagata tttctattct ccagtgccac ggggattgtg accctttggt tcccctgatg tttggttctc ttacggtgga aaaactaaaa acattggtga atccagccaa tgtgaccttt aaaacctatg aaggtatgat gcacagttcg tgtcaacagg aaatgatgga tgtcaagcaa ttcattgata aactcctacc tccaattgat tga. It is sometimes possible for the material contained within the vial of "LYPLA1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.