Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LYN cdna clone

LYN cDNA Clone

Gene Names
LYN; JTK8; p53Lyn; p56Lyn
Synonyms
LYN; LYN cDNA Clone; LYN cdna clone
Ordering
For Research Use Only!
Sequence
atgggatgtataaaatcaaaagggaaagacagcttgagtgacgatggagtagatttgaagactcaaccagtacgtaatactgaaagaactatttatgtgagagatccaacgtccaataaacagcaaaggccagttccagaatctcagcttttacctggacagaggtttcaaactaaagatccagaggaacaaggagacattgtggtagccttgtacccctatgatggcatccacccggacgacttgtctttcaagaaaggagagaagatgaaagtcctggaggagcatggagaatggtggaaagcaaagtcccttttaacaaaaaaagaaggcttcatccccagcaactatgtggccaaactcaacaccttagaaacagaagagtggtttttcaaggatataaccaggaaggacgcagaaaggcagcttttggcaccaggaaatagcgctggagctttccttattagagaaagtgaaacattaaaaggaagcttctctctgtctgtcagagactttgaccctgtgcatggtgatgttattaagcactacaaaattagaagtctggataatgggggctattacatctctccacgaatcacttttccctgtatcagcgacatgattaaacattaccaaaagcaggcagatggcttgtgcagaagattggagaaggcttgtattagtcccaagccacagaagccatgggataaagatgcctgggagatcccccgggagtccatcaagttggtgaaaaggcttggcgctgggcagtttggggaagtctggatgggttactataacaacagtaccaaggtggctgtgaaaaccctgaagccaggaactatgtctgtgcaagccttcctggaagaagccaacctcatgaagaccctgcagcatgacaagctcgtgaggctctacgctgtggtcaccagggaggagcccatttacatcatcaccgagtacatggccaagggcagtttgctggatttcctgaagagcgatgaaggtggcaaagtgctgcttccaaagctcattgacttttctgctcagattgcagagggaatggcatacatcgagcggaagaactacattcaccgggacctgcgagcagctaatgttctggtctccgagtcactcatgtgcaaaattgcagattttggccttgctagagtaattgaagataatgagtacacagcaagggaaggtgctaagttccctattaagtggacggctccagaagcaatcaactttggatgtttcactattaagtctgatgtgtggtcctttggaatcctcctatacgaaattgtcacctatgggaaaattccctacccagggagaactaatgccgacgtgatgaccgccctgtcccagggctacaggatgccccgtgtggagaactgcccagatgagctctatgacattatgaaaatgtgctggaaagaaaaggcagaagagagaccaacgtttgactacttacagagcgtcctggatgatttctacacagccacggaagggcaataccagcagcagccttag
Sequence Length
1539
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
56,033 Da
NCBI Official Full Name
Homo sapiens v-yes-1 Yamaguchi sarcoma viral related oncogene homolog, mRNA
NCBI Official Synonym Full Names
LYN proto-oncogene, Src family tyrosine kinase
NCBI Official Symbol
LYN
NCBI Official Synonym Symbols
JTK8; p53Lyn; p56Lyn
NCBI Protein Information
tyrosine-protein kinase Lyn
UniProt Protein Name
Tyrosine-protein kinase Lyn
Protein Family
UniProt Gene Name
LYN
UniProt Synonym Gene Names
JTK8
UniProt Entry Name
LYN_HUMAN

NCBI Description

This gene encodes a tyrosine protein kinase, which maybe involved in the regulation of mast cell degranulation, and erythroid differentiation. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]

Uniprot Description

LYN: a tyrosine kinase of the Src family that plays a role in B cell antigen-receptor signaling.

Protein type: EC 2.7.10.2; Oncoprotein; Protein kinase, tyrosine (non-receptor); Protein kinase, TK; Kinase, protein; TK group; Src family

Chromosomal Location of Human Ortholog: 8q13

Cellular Component: cytoplasm; cytosol; extrinsic to internal side of plasma membrane; Golgi apparatus; lipid raft; nucleus; perinuclear region of cytoplasm; plasma membrane

Molecular Function: non-membrane spanning protein tyrosine kinase activity; protein binding; protein-tyrosine kinase activity; receptor binding; receptor signaling protein tyrosine kinase activity

Biological Process: B cell homeostasis; blood coagulation; central nervous system development; ephrin receptor signaling pathway; erythrocyte differentiation; Fc receptor mediated inhibitory signaling pathway; Fc receptor mediated stimulatory signaling pathway; immune response-regulating cell surface receptor signaling pathway; inflammatory response; innate immune response; leukocyte migration; lipopolysaccharide-mediated signaling pathway; negative regulation of B cell proliferation; negative regulation of cell proliferation; negative regulation of immune response; negative regulation of MAP kinase activity; negative regulation of protein amino acid phosphorylation; negative regulation of toll-like receptor 2 signaling pathway; negative regulation of toll-like receptor 4 signaling pathway; peptidyl-tyrosine phosphorylation; platelet activation; platelet degranulation; positive regulation of cell motility; positive regulation of cell proliferation; positive regulation of tyrosine phosphorylation of STAT protein; protein amino acid autophosphorylation; protein amino acid phosphorylation; regulation of B cell apoptosis; regulation of B cell receptor signaling pathway; regulation of cell adhesion mediated by integrin; regulation of cytokine production; regulation of erythrocyte differentiation; regulation of mast cell activation; regulation of mast cell degranulation; regulation of protein amino acid phosphorylation; response to DNA damage stimulus; response to hormone stimulus; signal transduction; stimulatory C-type lectin receptor signaling pathway; T cell costimulation; tolerance induction to self antigen; transmembrane receptor protein tyrosine kinase signaling pathway

Research Articles on LYN

Similar Products

Product Notes

The LYN lyn (Catalog #AAA1275944) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggatgta taaaatcaaa agggaaagac agcttgagtg acgatggagt agatttgaag actcaaccag tacgtaatac tgaaagaact atttatgtga gagatccaac gtccaataaa cagcaaaggc cagttccaga atctcagctt ttacctggac agaggtttca aactaaagat ccagaggaac aaggagacat tgtggtagcc ttgtacccct atgatggcat ccacccggac gacttgtctt tcaagaaagg agagaagatg aaagtcctgg aggagcatgg agaatggtgg aaagcaaagt cccttttaac aaaaaaagaa ggcttcatcc ccagcaacta tgtggccaaa ctcaacacct tagaaacaga agagtggttt ttcaaggata taaccaggaa ggacgcagaa aggcagcttt tggcaccagg aaatagcgct ggagctttcc ttattagaga aagtgaaaca ttaaaaggaa gcttctctct gtctgtcaga gactttgacc ctgtgcatgg tgatgttatt aagcactaca aaattagaag tctggataat gggggctatt acatctctcc acgaatcact tttccctgta tcagcgacat gattaaacat taccaaaagc aggcagatgg cttgtgcaga agattggaga aggcttgtat tagtcccaag ccacagaagc catgggataa agatgcctgg gagatccccc gggagtccat caagttggtg aaaaggcttg gcgctgggca gtttggggaa gtctggatgg gttactataa caacagtacc aaggtggctg tgaaaaccct gaagccagga actatgtctg tgcaagcctt cctggaagaa gccaacctca tgaagaccct gcagcatgac aagctcgtga ggctctacgc tgtggtcacc agggaggagc ccatttacat catcaccgag tacatggcca agggcagttt gctggatttc ctgaagagcg atgaaggtgg caaagtgctg cttccaaagc tcattgactt ttctgctcag attgcagagg gaatggcata catcgagcgg aagaactaca ttcaccggga cctgcgagca gctaatgttc tggtctccga gtcactcatg tgcaaaattg cagattttgg ccttgctaga gtaattgaag ataatgagta cacagcaagg gaaggtgcta agttccctat taagtggacg gctccagaag caatcaactt tggatgtttc actattaagt ctgatgtgtg gtcctttgga atcctcctat acgaaattgt cacctatggg aaaattccct acccagggag aactaatgcc gacgtgatga ccgccctgtc ccagggctac aggatgcccc gtgtggagaa ctgcccagat gagctctatg acattatgaa aatgtgctgg aaagaaaagg cagaagagag accaacgttt gactacttac agagcgtcct ggatgatttc tacacagcca cggaagggca ataccagcag cagccttag. It is sometimes possible for the material contained within the vial of "LYN, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.