Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LUC7L2 cdna clone

LUC7L2 cDNA Clone

Gene Names
LUC7L2; CGI-59; CGI-74; LUC7B2
Synonyms
LUC7L2; LUC7L2 cDNA Clone; LUC7L2 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcggcgcaggcccagatgcgcgcgatgctggaccagttgatgggcacctcccgggacggagatacaactcgtcaacgaatcaaattcagtgatgacagagtatgcaagagtcaccttctcaactgttgtcctcatgatgtcctttctggaactagaatggatcttggagaatgtctgaaagtccatgacctggctttaagagcggattatgaaattgcatccaaagaacaagattttttctttgaacttgatgccatggatcatctgcagtcattcattgcagattgtgatcgtagaacagaagtggccaagaaaagattagcagaaactcaagaagagattagtgctgaagtagcagcaaaggcagaacgtgttcatgagttaaatgaagaaattggtaaattgttagccaaggtggaacaactaggagctgaagggaatgtggaggaatcccagaaagtaatggatgaagtagagaaagcacgggcaaagaaaagagaagcagaggaagtttatcggaattctatgccagcttccagttttcagcagcagaaacttcgagtctgtgaagtctgctctgcctatttaggacttcatgataatgacagacgactggctgatcattttgggggtaaactgcacctgggatttattgaaataagagagaagcttgaagaattaaagagagtcgtagctgagaagcaggagaaaagaaaccaggaacggctgaaacgaagagaagagagagagagagaagaaagggagaagctgaggaggtcccgatcacacagcaagaatccaaaaagatccaggtccagagagcatcgcagacatcgatctcgctccatgtcacgtgaacgcaagaggagaactcgatccaaatctcgggagaaacgccatcgccacaggtcccgctccagcagccgtagccgcagccgtagccaccagagaagtcggcacagttctagagataggagcagagaacgatccaagaggagatcctcaaaagaaagattcagagaccaagacttagcatcatgtgacagagacaggagttcaagagacagatcacctcgtgacagagatcggaaagataagaagcggtcctatgagagtgctaatggcagatcagaagacaggaggagctctgaagagcgcgaagcaggggagatctaa
Sequence Length
1179
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
46,229 Da
NCBI Official Full Name
Homo sapiens LUC7-like 2 (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
LUC7 like 2, pre-mRNA splicing factor
NCBI Official Symbol
LUC7L2
NCBI Official Synonym Symbols
CGI-59; CGI-74; LUC7B2
NCBI Protein Information
putative RNA-binding protein Luc7-like 2
UniProt Protein Name
Putative RNA-binding protein Luc7-like 2
UniProt Gene Name
LUC7L2
UniProt Entry Name
LC7L2_HUMAN

NCBI Description

This gene encodes a protein that contains a C2H2-type zinc finger, coiled-coil region and arginine, serine-rich (RS) domain. A similar protein in mouse interacts with sodium channel modifier 1, and the encoded protein may be involved in the recognition of non-consensus splice donor sites in association with the U1 snRNP spliceosomal subunit. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]

Uniprot Description

LUC7L2: a Luc7 family protein that may bind RNA via its Arg/Ser-rich domain. Contains 1 C2H2-type zinc finger. Two alternatively spliced isoforms have been described.

Protein type: RNA-binding; C2H2-type zinc finger protein

Chromosomal Location of Human Ortholog: 7q34

Cellular Component: snRNP U1

Molecular Function: enzyme binding; mRNA binding; protein binding

Biological Process: mRNA splice site selection

Research Articles on LUC7L2

Similar Products

Product Notes

The LUC7L2 luc7l2 (Catalog #AAA1273115) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcggcgc aggcccagat gcgcgcgatg ctggaccagt tgatgggcac ctcccgggac ggagatacaa ctcgtcaacg aatcaaattc agtgatgaca gagtatgcaa gagtcacctt ctcaactgtt gtcctcatga tgtcctttct ggaactagaa tggatcttgg agaatgtctg aaagtccatg acctggcttt aagagcggat tatgaaattg catccaaaga acaagatttt ttctttgaac ttgatgccat ggatcatctg cagtcattca ttgcagattg tgatcgtaga acagaagtgg ccaagaaaag attagcagaa actcaagaag agattagtgc tgaagtagca gcaaaggcag aacgtgttca tgagttaaat gaagaaattg gtaaattgtt agccaaggtg gaacaactag gagctgaagg gaatgtggag gaatcccaga aagtaatgga tgaagtagag aaagcacggg caaagaaaag agaagcagag gaagtttatc ggaattctat gccagcttcc agttttcagc agcagaaact tcgagtctgt gaagtctgct ctgcctattt aggacttcat gataatgaca gacgactggc tgatcatttt gggggtaaac tgcacctggg atttattgaa ataagagaga agcttgaaga attaaagaga gtcgtagctg agaagcagga gaaaagaaac caggaacggc tgaaacgaag agaagagaga gagagagaag aaagggagaa gctgaggagg tcccgatcac acagcaagaa tccaaaaaga tccaggtcca gagagcatcg cagacatcga tctcgctcca tgtcacgtga acgcaagagg agaactcgat ccaaatctcg ggagaaacgc catcgccaca ggtcccgctc cagcagccgt agccgcagcc gtagccacca gagaagtcgg cacagttcta gagataggag cagagaacga tccaagagga gatcctcaaa agaaagattc agagaccaag acttagcatc atgtgacaga gacaggagtt caagagacag atcacctcgt gacagagatc ggaaagataa gaagcggtcc tatgagagtg ctaatggcag atcagaagac aggaggagct ctgaagagcg cgaagcaggg gagatctaa. It is sometimes possible for the material contained within the vial of "LUC7L2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.