Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LTF cdna clone

LTF cDNA Clone

Gene Names
LTF; LF; HLF2; GIG12
Synonyms
LTF; LTF cDNA Clone; LTF cdna clone
Ordering
For Research Use Only!
Sequence
atgaaacttgtcttcctcgtcctgctgttcctcggggccctcggactgtgtctggctggcagtaggagaaggagtgttcagtggtgcgccgtatcccaacccgaggccacaaaatgcttccaatggcaaaggaatatgagaaaagtgcgtggccctcctgtcagctgcataaagagagactcccccatccagtgtatccaggccattgcggaaaacagggccgatgctgtgacccttgatggtggtttcatatacgaggcaggcctggccccctacaaactgcgacctgtagcggcggaagtctacgggaccgaaagacagccacgaactcactattatgccgtggctgtggtgaagaagggcggcagctttcagctgaacgaactgcaatgtctgaagtcctgccacacaggccttcgcaggaccgctggatggaatgtccctatagggacacttcgtccattcttgaattggacgggtccacctgagcccattgaggcagctgtggccaggttcttctcagccagctgtgttcccggtgcagataaaggacagttccccaacctgtgtcgcctgtgtgcggggacaggggaaaacaaatgtgccttctcctcccaggaaccgtacttcagctactctggtgccttcaagtgtctgagagacggggctggagacgtggcttttatcagagagagcacagtgtttgaggacctgtcagacgaggctgaaagggacgagtatgagttactctgcccagacaacactcggaagccagtggacaagttcaaagactgccatctggcccgggtcccttctcatgccgttgtggcacgaagtgtgaatggcaaggaggatgccatctggaatcttctccgccaggcacaggaaaagtttggaaaggacaagtcaccgaaattccagctctttggctcccctagtgggcagaaagatctgctgttcaaggactctgccattgggttttcgagggtgcccccgaggatagattctgggctgtaccttggctccggctacttcactgccatccagaacttgaggaaaagtgaggaggaagtggctgcccggcgtgcgcgggtcgtgtggtgtgcggtgggcgagcaggagctgcgcaagtgtaaccagtggagtggcttgagcgaaggcagcgtgacctgctcctcggcctccaccacagaggactgcatcgccctggtgctgaaaggagaagctgatgccatgagtttggatggaggatatgtgtacactgcaggcaaatgtggtttggtgcctgtcctggcagagaactacaaatcccaacaaagcagtgaccctgatcctaactgtgtggatagacctgtggaaggatatcttactgtggcggtggttaggagatcagacactagccttacctggaactctgtgaaaggcaagaagtcctgccacaccgccgtggacaggactgcaggctggaatatccccatgggcctgctcttcaaccagacgggctcctgcaaatttgatgaatatttcagtcaaagctgtgcccctgggtctgacccgagatctaatctctgtgctctgtgtattggcgacgagcagggtgagaataagtgcgtgcccaacagcaacgagagatactacggctacactggggctttccggtgcctggctgagaatgctggagacgttgcatttgtgaaagatgtcactgtcttgcagaacactgatggaaataacaatgaggcatgggctaaggatttgaagctggcagactttgcgctgctgtgcctcgatggcaaacggaagcctgtgactgaggctagaagctgccatcttgccatggccccgaatcatgccgtggtgtctcggatggataaggtggaacgcctgaaacaggtgttgctccaccaacaggctaaatttgggagaaatggatctgactgcccggacaagttttgcttattccagtctgaaaccaaaaaccttctgttcaatgacaacactgagtgtctggccagactccatggcaaaacaacatatgaaaaatatttggggccacagtatgtcgcaggcattactaatctgaaaaagtgctcaacctcccccctcctggaagcctgtgaattcctcaggaagtaa
Sequence Length
2136
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
Related Product Information for LTF cdna clone
Homo sapiens lactotranferrin, mRNA(cDNA clone MGC:13619 IMAGE: 4294752). Complete cds.

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
78,182 Da
NCBI Official Full Name
Homo sapiens lactotransferrin, mRNA
NCBI Official Synonym Full Names
lactotransferrin
NCBI Official Symbol
LTF
NCBI Official Synonym Symbols
LF; HLF2; GIG12
NCBI Protein Information
lactotransferrin; talalactoferrin; neutrophil lactoferrin; growth-inhibiting protein 12
UniProt Protein Name
Lactotransferrin
Protein Family
UniProt Gene Name
LTF
UniProt Synonym Gene Names
GIG12; LF; Lactoferrin; Lfcin-H
UniProt Entry Name
TRFL_HUMAN

NCBI Description

This gene is a member of the transferrin family of genes and its protein product is found in the secondary granules of neutrophils. The protein is a major iron-binding protein in milk and body secretions with an antimicrobial activity, making it an important component of the non-specific immune system. The protein demonstrates a broad spectrum of properties, including regulation of iron homeostasis, host defense against a broad range of microbial infections, anti-inflammatory activity, regulation of cellular growth and differentiation and protection against cancer development and metastasis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]

Uniprot Description

LTF: Transferrins are iron binding transport proteins which can bind two Fe(3+) ions in association with the binding of an anion, usually bicarbonate. Belongs to the transferrin family. 2 isoforms of the human protein are produced by alternative promoter.

Protein type: EC 3.4.21.-; Protease; Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 3p21.31

Cellular Component: extracellular space; specific granule; cytoplasm; extracellular region; nucleus; secretory granule

Molecular Function: heparin binding; protein serine/threonine kinase activator activity; protein binding; ferric iron binding; DNA binding; iron ion binding; serine-type endopeptidase activity

Biological Process: negative regulation of lipopolysaccharide-mediated signaling pathway; interaction with host; ossification; positive regulation of I-kappaB kinase/NF-kappaB cascade; transcription, DNA-dependent; positive regulation of toll-like receptor 4 signaling pathway; antifungal humoral response; proteolysis; iron ion transport; humoral immune response; regulation of cytokine production; activation of NF-kappaB transcription factor; retinal homeostasis; positive regulation of osteoblast differentiation; negative regulation of viral genome replication; innate immune response in mucosa; response to host immune response; positive regulation of osteoblast proliferation; antibacterial humoral response; regulation of tumor necrosis factor production; negative regulation of viral reproduction; negative regulation of ATPase activity; iron assimilation by chelation and transport; negative regulation of apoptosis

Research Articles on LTF

Similar Products

Product Notes

The LTF ltf (Catalog #AAA1278850) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaacttg tcttcctcgt cctgctgttc ctcggggccc tcggactgtg tctggctggc agtaggagaa ggagtgttca gtggtgcgcc gtatcccaac ccgaggccac aaaatgcttc caatggcaaa ggaatatgag aaaagtgcgt ggccctcctg tcagctgcat aaagagagac tcccccatcc agtgtatcca ggccattgcg gaaaacaggg ccgatgctgt gacccttgat ggtggtttca tatacgaggc aggcctggcc ccctacaaac tgcgacctgt agcggcggaa gtctacggga ccgaaagaca gccacgaact cactattatg ccgtggctgt ggtgaagaag ggcggcagct ttcagctgaa cgaactgcaa tgtctgaagt cctgccacac aggccttcgc aggaccgctg gatggaatgt ccctataggg acacttcgtc cattcttgaa ttggacgggt ccacctgagc ccattgaggc agctgtggcc aggttcttct cagccagctg tgttcccggt gcagataaag gacagttccc caacctgtgt cgcctgtgtg cggggacagg ggaaaacaaa tgtgccttct cctcccagga accgtacttc agctactctg gtgccttcaa gtgtctgaga gacggggctg gagacgtggc ttttatcaga gagagcacag tgtttgagga cctgtcagac gaggctgaaa gggacgagta tgagttactc tgcccagaca acactcggaa gccagtggac aagttcaaag actgccatct ggcccgggtc ccttctcatg ccgttgtggc acgaagtgtg aatggcaagg aggatgccat ctggaatctt ctccgccagg cacaggaaaa gtttggaaag gacaagtcac cgaaattcca gctctttggc tcccctagtg ggcagaaaga tctgctgttc aaggactctg ccattgggtt ttcgagggtg cccccgagga tagattctgg gctgtacctt ggctccggct acttcactgc catccagaac ttgaggaaaa gtgaggagga agtggctgcc cggcgtgcgc gggtcgtgtg gtgtgcggtg ggcgagcagg agctgcgcaa gtgtaaccag tggagtggct tgagcgaagg cagcgtgacc tgctcctcgg cctccaccac agaggactgc atcgccctgg tgctgaaagg agaagctgat gccatgagtt tggatggagg atatgtgtac actgcaggca aatgtggttt ggtgcctgtc ctggcagaga actacaaatc ccaacaaagc agtgaccctg atcctaactg tgtggataga cctgtggaag gatatcttac tgtggcggtg gttaggagat cagacactag ccttacctgg aactctgtga aaggcaagaa gtcctgccac accgccgtgg acaggactgc aggctggaat atccccatgg gcctgctctt caaccagacg ggctcctgca aatttgatga atatttcagt caaagctgtg cccctgggtc tgacccgaga tctaatctct gtgctctgtg tattggcgac gagcagggtg agaataagtg cgtgcccaac agcaacgaga gatactacgg ctacactggg gctttccggt gcctggctga gaatgctgga gacgttgcat ttgtgaaaga tgtcactgtc ttgcagaaca ctgatggaaa taacaatgag gcatgggcta aggatttgaa gctggcagac tttgcgctgc tgtgcctcga tggcaaacgg aagcctgtga ctgaggctag aagctgccat cttgccatgg ccccgaatca tgccgtggtg tctcggatgg ataaggtgga acgcctgaaa caggtgttgc tccaccaaca ggctaaattt gggagaaatg gatctgactg cccggacaag ttttgcttat tccagtctga aaccaaaaac cttctgttca atgacaacac tgagtgtctg gccagactcc atggcaaaac aacatatgaa aaatatttgg ggccacagta tgtcgcaggc attactaatc tgaaaaagtg ctcaacctcc cccctcctgg aagcctgtga attcctcagg aagtaa. It is sometimes possible for the material contained within the vial of "LTF, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.