Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LTB4R cdna clone

LTB4R cDNA Clone

Synonyms
LTB4R; LTB4R cDNA Clone; LTB4R cdna clone
Ordering
For Research Use Only!
Sequence
atgaacactacatcttctgcagcacccccctcactaggtgtagagttcatctctctgctggctatcatcctgctgtcagtggcgctggctgtggggcttcccggcaacagctttgtggtgtggagtatcctgaaaaggatgcagaagcgctctgtcactgccctgatggtgctgaacctggccctggccgacctggccgtattgctcactgctccctttttccttcacttcctggcccaaggcacctggagttttggactggctggttgccgcctgtgtcactatgtctgcggagtcagcatgtacgccagcgtcctgcttatcacggccatgagtctagaccgctcactggcggtggcccgcccctttgtgtcccagaagctacgcaccaaggcgatggcccggcgggtgctggcaggcatctgggtgttgtcctttctgctggccacacccgtcctcgcgtaccgcacagtagtgccctggaaaacgaacatgagcctgtgcttcccgcggtaccccagcgaagggcaccgggccttccatctaatcttcgaggctgtcacgggcttcctgctgcccttcctggctgtggtggccagctactcggacatagggcgtcggctacaggcccggcgcttccgccgcagccgccgcaccggccgcctggtggtgctcatcatcctgaccttcgccgccttctggctgccctaccacgtggtgaacctggctgaggcgggccgcgcgctggccggccaggccgccgggttagggctcgtggggaagcggctgagcctggcccgcaacgtgctcatcgcactcgccttcctgagcagcagcgtgaaccccgtgctgtacgcgtgcgccggcggcggcctgctgcgctcggcgggcgtgggcttcgtcgccaagctgctggagggcacgggctccgaggcgtccagcacgcgccgcgggggcagcctgggccagaccgctaggagcggccccgccgctttggagcccggcccttccgagagcctcactgcctccagccctttcaagttaaacgaactgaactag
Sequence Length
1059
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
37,557 Da
NCBI Official Full Name
Homo sapiens leukotriene B4 receptor, mRNA
UniProt Protein Name
Leukotriene B4 receptor 1
Protein Family
UniProt Gene Name
LTB4R
UniProt Synonym Gene Names
BLT; BLT1; BLTR; CMKRL1; GPR16; P2RY7; LTB4-R 1; LTB4-R1; P2Y7
UniProt Entry Name
LT4R1_HUMAN

Uniprot Description

LTB4R: Receptor for extracellular ATP > UTP and ADP. The activity of this receptor is mediated by G proteins which activate a phosphatidylinositol-calcium second messenger system. May be the cardiac P2Y receptor involved in the regulation of cardiac muscle contraction through modulation of L-type calcium currents. Is a receptor for leukotriene B4, a potent chemoattractant involved in inflammation and immune response. Belongs to the G-protein coupled receptor 1 family.

Protein type: Receptor, GPCR; Membrane protein, multi-pass; GPCR, family 1; Membrane protein, integral

Chromosomal Location of Human Ortholog: 14q11.2-q12

Cellular Component: integral to plasma membrane; plasma membrane

Molecular Function: leukotriene B4 receptor activity; leukotriene receptor activity; nucleotide binding; peptide receptor activity, G-protein coupled

Biological Process: cell motility; G-protein coupled receptor protein signaling pathway; G-protein signaling, coupled to IP3 second messenger (phospholipase C activating); immune response; muscle contraction; neuropeptide signaling pathway

Similar Products

Product Notes

The LTB4R ltb4r (Catalog #AAA1273779) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaacacta catcttctgc agcacccccc tcactaggtg tagagttcat ctctctgctg gctatcatcc tgctgtcagt ggcgctggct gtggggcttc ccggcaacag ctttgtggtg tggagtatcc tgaaaaggat gcagaagcgc tctgtcactg ccctgatggt gctgaacctg gccctggccg acctggccgt attgctcact gctccctttt tccttcactt cctggcccaa ggcacctgga gttttggact ggctggttgc cgcctgtgtc actatgtctg cggagtcagc atgtacgcca gcgtcctgct tatcacggcc atgagtctag accgctcact ggcggtggcc cgcccctttg tgtcccagaa gctacgcacc aaggcgatgg cccggcgggt gctggcaggc atctgggtgt tgtcctttct gctggccaca cccgtcctcg cgtaccgcac agtagtgccc tggaaaacga acatgagcct gtgcttcccg cggtacccca gcgaagggca ccgggccttc catctaatct tcgaggctgt cacgggcttc ctgctgccct tcctggctgt ggtggccagc tactcggaca tagggcgtcg gctacaggcc cggcgcttcc gccgcagccg ccgcaccggc cgcctggtgg tgctcatcat cctgaccttc gccgccttct ggctgcccta ccacgtggtg aacctggctg aggcgggccg cgcgctggcc ggccaggccg ccgggttagg gctcgtgggg aagcggctga gcctggcccg caacgtgctc atcgcactcg ccttcctgag cagcagcgtg aaccccgtgc tgtacgcgtg cgccggcggc ggcctgctgc gctcggcggg cgtgggcttc gtcgccaagc tgctggaggg cacgggctcc gaggcgtcca gcacgcgccg cgggggcagc ctgggccaga ccgctaggag cggccccgcc gctttggagc ccggcccttc cgagagcctc actgcctcca gccctttcaa gttaaacgaa ctgaactag. It is sometimes possible for the material contained within the vial of "LTB4R, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.