LTA4H cdna clone
LTA4H cDNA Clone
Synonyms
LTA4H; LTA4H cDNA Clone; LTA4H cdna clone
Sequence
atgcccgagatagtggatacctgttcgttggcctctccggcttccgtctgccggaccaagcacctgcacctgcgctgcagcgtcgactttactcgccggacgctgaccgggactgctgctctcacggtccagtctcaggaggacaatctgcgcagcctggttttggatacaaaggaccttacaatagaaaaagtagtgatcaatggacaagaagtcaaatatgctcttggagaaagacaaagttacaagggatcgccaatggaaatctctcttcctatcgctttgagcaaaaatcaagaaattgttatagaaatttcttttgagacctctccaaaatcttctgctctccagtggctcactcctgaacagacttctgggaaggaacacccatatctctttagtcagtgccaggccatccactgcagagcaatccttccttgtcaggacactccttctgtgaaattaacctatactgcagaggtgtctgtccctaaagaactggtggcacttatgagtgctattcgtgatggagaaacacctgacccagaagacccaagcaggaaaatatacaaattcatccaaaaagttccaataccctgctacctgattgctttagttgttggagctttagaaagcaggcaaattggcccaagaactttggtgtggtctgagaaagagcaggtggaaaagtctgcttatgagttttctgagactgaatctatgcttaaaatagcagaagatctgggaggaccgtatgtatggggacagtatgacctattggtcctgccaccatccttcccttatggtggcatggagaatccttgccttacttttgtaactcctactctactggcaggcgacaagtcactctccaatgtcattgcacatgaaatatctcatagctggacagggaatctagtgaccaacaaaacttgggatcacttttggttaaatgagggacatactgtgtacttggaacgccacatttgcggacgattgtttggtgaaaagttcagacattttaatgctctgggaggatggggagaactacagaattcggtaaagacatttggggagacacatcctttcaccaaacttgtggttgatctgacagatatagaccctgatgtagcttattcttcagttccctatgagaagggctttgctttacttttttaccttgaacaactgcttggaggaccagagattttcctaggattcttaaaagcttatgttgagaagttttcctataagagcataactactgatgactggaaggatttcctgtattcctattttaaagataaggttgatgttctcaatcaagttgattggaatgcctggctctactctcctggactgcctcccataaagcccaattatgatatgactctgacaaatgcttgtattgccttaagtcaaagatggattactgccaaagaagatgatttaaattcattcaatgccacagacctgaaggatctctcttctcatcaattgaatgagtttttagcacagacgctccagagggcacctcttccattggggcacataaagcgaatgcaagaggtgtacaacttcaatgccattaacaattctgaaatacgattcagatggctgcggctctgcattcaatccaagtgggaggacgcaattcctttggcgctaaagatggcaactgaacaaggaagaatgaagtttacccggcccttattcaaggatcttgctgcctttgacaaatcccatgatcaagctgtccgaacctaccaagagcacaaagcaagcatgcatcccgtgactgcaatgctggtggggaaagacttaaaagtggattaa
Sequence Length
1836
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
66,852 Da
NCBI Official Full Name
Homo sapiens leukotriene A4 hydrolase, mRNA
NCBI Official Synonym Full Names
leukotriene A4 hydrolase
NCBI Official Symbol
LTA4H
NCBI Protein Information
leukotriene A-4 hydrolase
UniProt Protein Name
Leukotriene A-4 hydrolase
Protein Family
UniProt Gene Name
LTA4H
UniProt Synonym Gene Names
LTA4; LTA-4 hydrolase
UniProt Entry Name
LKHA4_HUMAN
NCBI Description
The protein encoded by this gene is an enzyme that contains both hydrolase and aminopeptidase activities. The hydrolase activity is used in the final step of the biosynthesis of leukotriene B4, a proinflammatory mediator. The aminopeptidase activity has been shown to degrade proline-glycine-proline (PGP), a neutrophil chemoattractant and biomarker for chronic obstructive pulmonary disease (COPD). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
Uniprot Description
LTA4H: Epoxide hydrolase that catalyzes the final step in the biosynthesis of the proinflammatory mediator leukotriene B4. Has also aminopeptidase activity. Belongs to the peptidase M1 family. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: Lipid Metabolism - arachidonic acid; Hydrolase; EC 3.3.2.6
Chromosomal Location of Human Ortholog: 12q22
Cellular Component: cytoplasm; cytosol; nucleoplasm; nucleus; plasma membrane
Molecular Function: aminopeptidase activity; epoxide hydrolase activity; leukotriene-A4 hydrolase activity; peptidase activity; peptide binding; protein binding; zinc ion binding
Biological Process: leukotriene biosynthetic process; leukotriene metabolic process; peptide catabolic process
Research Articles on LTA4H
Similar Products
Product Notes
The LTA4H lta4h (Catalog #AAA1270258) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcccgaga tagtggatac ctgttcgttg gcctctccgg cttccgtctg ccggaccaag cacctgcacc tgcgctgcag cgtcgacttt actcgccgga cgctgaccgg gactgctgct ctcacggtcc agtctcagga ggacaatctg cgcagcctgg ttttggatac aaaggacctt acaatagaaa aagtagtgat caatggacaa gaagtcaaat atgctcttgg agaaagacaa agttacaagg gatcgccaat ggaaatctct cttcctatcg ctttgagcaa aaatcaagaa attgttatag aaatttcttt tgagacctct ccaaaatctt ctgctctcca gtggctcact cctgaacaga cttctgggaa ggaacaccca tatctcttta gtcagtgcca ggccatccac tgcagagcaa tccttccttg tcaggacact ccttctgtga aattaaccta tactgcagag gtgtctgtcc ctaaagaact ggtggcactt atgagtgcta ttcgtgatgg agaaacacct gacccagaag acccaagcag gaaaatatac aaattcatcc aaaaagttcc aataccctgc tacctgattg ctttagttgt tggagcttta gaaagcaggc aaattggccc aagaactttg gtgtggtctg agaaagagca ggtggaaaag tctgcttatg agttttctga gactgaatct atgcttaaaa tagcagaaga tctgggagga ccgtatgtat ggggacagta tgacctattg gtcctgccac catccttccc ttatggtggc atggagaatc cttgccttac ttttgtaact cctactctac tggcaggcga caagtcactc tccaatgtca ttgcacatga aatatctcat agctggacag ggaatctagt gaccaacaaa acttgggatc acttttggtt aaatgaggga catactgtgt acttggaacg ccacatttgc ggacgattgt ttggtgaaaa gttcagacat tttaatgctc tgggaggatg gggagaacta cagaattcgg taaagacatt tggggagaca catcctttca ccaaacttgt ggttgatctg acagatatag accctgatgt agcttattct tcagttccct atgagaaggg ctttgcttta cttttttacc ttgaacaact gcttggagga ccagagattt tcctaggatt cttaaaagct tatgttgaga agttttccta taagagcata actactgatg actggaagga tttcctgtat tcctatttta aagataaggt tgatgttctc aatcaagttg attggaatgc ctggctctac tctcctggac tgcctcccat aaagcccaat tatgatatga ctctgacaaa tgcttgtatt gccttaagtc aaagatggat tactgccaaa gaagatgatt taaattcatt caatgccaca gacctgaagg atctctcttc tcatcaattg aatgagtttt tagcacagac gctccagagg gcacctcttc cattggggca cataaagcga atgcaagagg tgtacaactt caatgccatt aacaattctg aaatacgatt cagatggctg cggctctgca ttcaatccaa gtgggaggac gcaattcctt tggcgctaaa gatggcaact gaacaaggaa gaatgaagtt tacccggccc ttattcaagg atcttgctgc ctttgacaaa tcccatgatc aagctgtccg aacctaccaa gagcacaaag caagcatgca tcccgtgact gcaatgctgg tggggaaaga cttaaaagtg gattaa. It is sometimes possible for the material contained within the vial of "LTA4H, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
