LSM14A cdna clone
LSM14A cDNA Clone
Synonyms
LSM14A; LSM14A cDNA Clone; LSM14A cdna clone
Sequence
atgagcgggggcaccccttacatcggcagcaagatcagcctcatctccaaggcggagatccgctacgagggcatcctctacaccatcgacaccgaaaactccaccgtagcccttgccaaagttcgatcctttggtacagaagacagaccgacagatcgtccaataccacctcgagatgaagtctttgaatacattatattccgtgggagtgacattaaagaccttactgtttgtgagccaccaaaaccacagtgttctttgcctcaagacccagctattgttcagtcctcactaggctcatcgacttcttcattccagtccatgggttcttatggacctttcggcaggatgcccacatacagtcagttcagtccgagttccttagttgggcagcagtttggtgctgttggtgttgctggaagctctttgacatcctttggaacagaaacatcaaacagtggtaccttaccccaaagtagtgcggttggttctgcctttacacaggatacaagatctctaaaaacacagttatctcaaggtcgctcaagccctcagttagaccctttgagaaaaagcccaaccatggaacaagcagtgcagaccgcctcagcccacttacctgctccagcagctgttgggagaaggagtcctgtatcaaccaggcctttgccatctgccagccaaaaggcaggagagaatcaggagcacaggcgagctgaagtacacaaagtttcaaggccagaaaatgagcaactcagaaatgataacaagagacaagtagctccaggtgctccttcagctccaaggagagggcgtgggggtcatcggggtggcaggggaagatttggtattcggcgagatgggccaatgaaatttgagaaagactttgactttgaaagtgcaaatgcacaattcaacaaggaagagattgacagagagtttcataataaacttaaattaaaagaagataaacttgagaaacaggagaagcctgtaaatggtgaagataaaggagactcaggagttgatacccaaaacagtgaaggaaatgccgatgaagaagatccacttggacctaattgctattatgacaaaactaaatccttctttgataatatttcttgtgatgacaatagagaacggagaccaacctgggctgaagaaagaagattaaatgctgaaacatttggaatcccacttcgtccaaaccgtggccgtgggggatacagaggcagaggaggtcttggtttccgtggtggcagagggcgtggtggtggcagaggtggtaccttcactgcccctcgaggatttcgcggtggattcagaggaggtcgtgggggccgggagtttgcggattttgaatataggaaagacaacaaagttgctgcatag
Sequence Length
1392
Vector
pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
46,411 Da
NCBI Official Full Name
Homo sapiens LSM14A, SCD6 homolog A (S. cerevisiae), mRNA
UniProt Protein Name
Protein LSM14 homolog A
Protein Family
UniProt Gene Name
LSM14A
UniProt Synonym Gene Names
C19orf13; FAM61A; RAP55; RAP55A; AlphaSNBP; hRAP55; hRAP55A
UniProt Entry Name
LS14A_HUMAN
Uniprot Description
alphaSNBP(A): Essential for formation of P-bodies, cytoplasmic structures that provide storage sites for non-translating mRNAs. Belongs to the LSM14 family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Translation; RNA-binding
Chromosomal Location of Human Ortholog: 19q13.11
Cellular Component: cytoplasm; intracellular membrane-bound organelle; stress granule
Biological Process: cytoplasmic mRNA processing body assembly
Similar Products
Product Notes
The LSM14A lsm14a (Catalog #AAA1268281) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagcgggg gcacccctta catcggcagc aagatcagcc tcatctccaa ggcggagatc cgctacgagg gcatcctcta caccatcgac accgaaaact ccaccgtagc ccttgccaaa gttcgatcct ttggtacaga agacagaccg acagatcgtc caataccacc tcgagatgaa gtctttgaat acattatatt ccgtgggagt gacattaaag accttactgt ttgtgagcca ccaaaaccac agtgttcttt gcctcaagac ccagctattg ttcagtcctc actaggctca tcgacttctt cattccagtc catgggttct tatggacctt tcggcaggat gcccacatac agtcagttca gtccgagttc cttagttggg cagcagtttg gtgctgttgg tgttgctgga agctctttga catcctttgg aacagaaaca tcaaacagtg gtaccttacc ccaaagtagt gcggttggtt ctgcctttac acaggataca agatctctaa aaacacagtt atctcaaggt cgctcaagcc ctcagttaga ccctttgaga aaaagcccaa ccatggaaca agcagtgcag accgcctcag cccacttacc tgctccagca gctgttggga gaaggagtcc tgtatcaacc aggcctttgc catctgccag ccaaaaggca ggagagaatc aggagcacag gcgagctgaa gtacacaaag tttcaaggcc agaaaatgag caactcagaa atgataacaa gagacaagta gctccaggtg ctccttcagc tccaaggaga gggcgtgggg gtcatcgggg tggcagggga agatttggta ttcggcgaga tgggccaatg aaatttgaga aagactttga ctttgaaagt gcaaatgcac aattcaacaa ggaagagatt gacagagagt ttcataataa acttaaatta aaagaagata aacttgagaa acaggagaag cctgtaaatg gtgaagataa aggagactca ggagttgata cccaaaacag tgaaggaaat gccgatgaag aagatccact tggacctaat tgctattatg acaaaactaa atccttcttt gataatattt cttgtgatga caatagagaa cggagaccaa cctgggctga agaaagaaga ttaaatgctg aaacatttgg aatcccactt cgtccaaacc gtggccgtgg gggatacaga ggcagaggag gtcttggttt ccgtggtggc agagggcgtg gtggtggcag aggtggtacc ttcactgccc ctcgaggatt tcgcggtgga ttcagaggag gtcgtggggg ccgggagttt gcggattttg aatataggaa agacaacaaa gttgctgcat ag. It is sometimes possible for the material contained within the vial of "LSM14A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
