Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LRRC48 cdna clone

LRRC48 cDNA Clone

Gene Names
DRC3; LRRC48; CFAP134
Synonyms
LRRC48; LRRC48 cDNA Clone; LRRC48 cdna clone
Ordering
For Research Use Only!
Sequence
atgaaccagccgtgcaactcgatggagccgagggtgatggacgatgacatgctcaagctggccgtcggggaccagggcccccaggaggaggccgggcagctggccaagcaggagggcatcctcttcaaggatgtcctgtccctgcagctggactttcggaacatcctccgcatagacaacctctggcagtttgagaacttgaggaagctgcagctggacaataacatcattgagaagatcgagggcctggagaacctcgcacacctggtctggctggatctgtctttcaacaacattgagaccatcgaggggctggacacactggtgaacctggaggacctgagcttgttcaacaaccggatctccaagatcgactccctggacgccctcgtcaagctgcaggtgttgtcgctgggcaacaaccggattgacaacatgatgaacatcatctacctccggcggttcaagtgcctgcggacgctcagcctctctaggaaccctatctctgaggcagaggattacaagatgttcatctgtgcctaccttcctgacctcatgtacctggactaccggcgcattgatgaccacacaaaaaagcttgcggaggctaagcaccagtacagcatcgacgagctgaagcaccaggagaacctgatgcaggcccagctggaggacgagcaggcgcagcgggaggagctagagaagcacaagactgcgtttgtggaacacctgaatggctccttcctgtttgacagcatgtacgctgaggactcagagggcaacaatctgtcctacctgcctggtgtcggtgagctccttgagacctacaaggacaagtttgtcatcatctgcgtgaatatttttgagtatggcctgaaacagcaggagaagcggaaaacagagcttgacaccttcagtgaatgtgtccgtgaggccatccaggaaaaccaggagcagggcaaacgcaagattgccaaattcgaggagaagcacttgtcgagtttaagtgccattcgagaggagttggaactgcccaacattgagaagatgatcctagaatgcagtgctgacatcagtgagttgttcgatgcgctcatgacgctggagatgcagctggtggagcagctggaggagactataaacatgtttgaaaggaacattgttgacatggtaggactgtttatcgaaaatgtccaaagcctgatggctcagtgccgggacctggagaatcaccaccacgagaagctcctggagatctctatcagcaccctggagaagattgtcgagggcgacctggacgaggacctgcctaacgacctgcgcgcgctttttgtcgataaagatacgattgttaatgctgtcggggcatcgcacgacatccacctcctgaagattgacaatcgagaagatgagctggtgaccagaatcaactcttggtgtacacgtttaatagacaggattcacaaggatgagatcatgaggaaccgcaagcgcgtgaaggagatcaatcagtacatcgaccacatgcagagcgaactggacaacctggaatgtggcgacatcctagactag
Sequence Length
1572
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
53,205 Da
NCBI Official Full Name
Homo sapiens leucine rich repeat containing 48, mRNA
NCBI Official Synonym Full Names
dynein regulatory complex subunit 3
NCBI Official Symbol
DRC3
NCBI Official Synonym Symbols
LRRC48; CFAP134
NCBI Protein Information
dynein regulatory complex subunit 3
UniProt Protein Name
Dynein regulatory complex subunit 3
UniProt Gene Name
DRC3
UniProt Synonym Gene Names
LRRC48
UniProt Entry Name
DRC3_HUMAN

Uniprot Description

LRRC48: 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Unknown function

Chromosomal Location of Human Ortholog: 17p11.2

Cellular Component: cytoplasm

Research Articles on LRRC48

Similar Products

Product Notes

The LRRC48 drc3 (Catalog #AAA1275702) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaccagc cgtgcaactc gatggagccg agggtgatgg acgatgacat gctcaagctg gccgtcgggg accagggccc ccaggaggag gccgggcagc tggccaagca ggagggcatc ctcttcaagg atgtcctgtc cctgcagctg gactttcgga acatcctccg catagacaac ctctggcagt ttgagaactt gaggaagctg cagctggaca ataacatcat tgagaagatc gagggcctgg agaacctcgc acacctggtc tggctggatc tgtctttcaa caacattgag accatcgagg ggctggacac actggtgaac ctggaggacc tgagcttgtt caacaaccgg atctccaaga tcgactccct ggacgccctc gtcaagctgc aggtgttgtc gctgggcaac aaccggattg acaacatgat gaacatcatc tacctccggc ggttcaagtg cctgcggacg ctcagcctct ctaggaaccc tatctctgag gcagaggatt acaagatgtt catctgtgcc taccttcctg acctcatgta cctggactac cggcgcattg atgaccacac aaaaaagctt gcggaggcta agcaccagta cagcatcgac gagctgaagc accaggagaa cctgatgcag gcccagctgg aggacgagca ggcgcagcgg gaggagctag agaagcacaa gactgcgttt gtggaacacc tgaatggctc cttcctgttt gacagcatgt acgctgagga ctcagagggc aacaatctgt cctacctgcc tggtgtcggt gagctccttg agacctacaa ggacaagttt gtcatcatct gcgtgaatat ttttgagtat ggcctgaaac agcaggagaa gcggaaaaca gagcttgaca ccttcagtga atgtgtccgt gaggccatcc aggaaaacca ggagcagggc aaacgcaaga ttgccaaatt cgaggagaag cacttgtcga gtttaagtgc cattcgagag gagttggaac tgcccaacat tgagaagatg atcctagaat gcagtgctga catcagtgag ttgttcgatg cgctcatgac gctggagatg cagctggtgg agcagctgga ggagactata aacatgtttg aaaggaacat tgttgacatg gtaggactgt ttatcgaaaa tgtccaaagc ctgatggctc agtgccggga cctggagaat caccaccacg agaagctcct ggagatctct atcagcaccc tggagaagat tgtcgagggc gacctggacg aggacctgcc taacgacctg cgcgcgcttt ttgtcgataa agatacgatt gttaatgctg tcggggcatc gcacgacatc cacctcctga agattgacaa tcgagaagat gagctggtga ccagaatcaa ctcttggtgt acacgtttaa tagacaggat tcacaaggat gagatcatga ggaaccgcaa gcgcgtgaag gagatcaatc agtacatcga ccacatgcag agcgaactgg acaacctgga atgtggcgac atcctagact ag. It is sometimes possible for the material contained within the vial of "LRRC48, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.