Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LRP6 cdna clone

LRP6 cDNA Clone

Gene Names
LRP6; ADCAD2; STHAG7
Synonyms
LRP6; LRP6 cDNA Clone; LRP6 cdna clone
Ordering
For Research Use Only!
Sequence
atgggggccgtcctgaggagcctcctggcctgcagcttctgtgtgctcctgagagcggcccctttgttgctttatgcaaacagacgggacttgcgattggttgatgctacaaatggcaaagagaatgctacgattgtagttggaggcttggaggatgcagctgcggtggactttgtgtttagtcatggcttgatatactggagtgatgtcagcgaagaagccattaaacgaacagaatttaacaaaactgagagtgtgcagaatgttgttgtttctggattattgtcccccgatgggctggcatgtgattggcttggagaaaaattgtactggacagattctgaaactaatcggattgaagtttctaatttagatggatctttacgaaaagttttattttggcaagagttggatcaacccagagctattgccttagatccttcaagtgggttcatgtactggacagactggggagaagtgccaaagatagaacgtgctggaatggatggttcaagtcgcttcattataataaacagtgaaatttactggccaaatggactgactttggattatgaagaacaaaagctttattgggcagatgcaaaacttaatttcatccacaaatcaaatctggatggaacaaatcggcaggcagtggttaaaggttcccttccacatccttttgccttgacgttatttgaggacatattgtactggactgactggagcacacactccattttggcttgcaacaagtatactggtgagggtctgcgtgaaatccattctgacatcttctctcccatggatatacatgccttcagccaacagaggcagccaaatgccacaaatccatgtggaattgacaatgggggttgttcccatttgtgtttgatgtctccagtcaagcctttttatcagtgtgcttgccccactggggtcaaactcctggagaatggaaaaacctgcaaagatggtgccacagaattattgcttttagctcgaaggacagacttgagacgcatttctttggatacaccagattttacagacattgttctgcagttagaagacatccgtcatgccattgccatagattacgatcctgtggaaggctacatctactggactgatgatgaagtgagggccatacgccgttcatttatagatggatctggcagtcagtttgtggtcactgctcaaattgcccatcctgatggtattgctgtggactgggttgcacgaaatctttattggacagacactggcactgatcgaatagaagtgacaaggctcaatgggaccatgaggaagatcttgatttcagaggacttagaggaaccccgggctattgtgttagatcccatggttgggtacatgtattggactgactggggagaaattccgaaaattgagcgagcagctctggatggttctgaccgtgtagtattggttaacacttctcttggttggccaaatggtttagccttggattatgatgaaggcaaaatatactggggagatgccaaaacagacaagattgaggttatgaatactgatggcactgggagacgagtactagtggaagacaaaattcctcacatatttggatttactttgttgggtgactatgtttactggactgactggcagaggcgtagcattgaaagagttcataaacgaagtgcagagagggaagtgatcatagatcagctgcctgacctcatgggcctaaaggctacaaatgttcatcgagtgattggttccaacccctgtgctgaggaaaacgggggatgtagccatctctgcctctatagacctcagggccttcgctgtgcttgccctattggctttgaactcatcagtgacatgaagacctgcattgtcccagaggctttccttttgttttcacggagagcagatatcagacgaatttctctggaaacaaacaataataatgtggctattccactcactggtgtcaaagaagcttctgctttggattttgatgtgacagacaaccgaatttattggactgatatatcactcaagaccatcagcagagcctttatgaatggcagtgcactggaacatgtggtagaattcggcttagattatccagaaggcatggcagtagactggcttgggaagaacttgtactgggcagacacaggaacgaatcgaattgaggtgtcaaagttggatgggcagcaccgacaagttttggtgtggaaagacctagatagtcccagagctctcgcgttggaccctgccgaaggatttatgtattggactgaatggggtggaaaacctaagatagacagagctgcaatggatggaagtgaacgtactaccttagttccaaatgtggggcgggcaaacggcctaactattgattatgctaaaaggaggctttattggacagacctggacaccaacttaatagaatcttcaaatatgcttgggctcaaccgtgaagttatagcagatgacttgcctcatccttttggcttaactcagtaccaagattatatctactggacggactggagccgacgcagcattgagcgtgccaacaaaaccagtggccaaaaccgcaccatcattcagggccatttggattatgtgatggacatcctcgtctttcactcatctcgacagtcagggtggaatgaatgtgcttccagcaatgggcactgctcccacctctgcttggctgtgccagttgggggttttgtttgtggatgccctgcccactactctcttaatgctgacaacaggacttgtagtgctcctacgactttcctgctcttcagtcaaaagagtgccatcaaccgcatggtgattgatgaacaacagagccccgacatcatccttcccatccacagccttcggaatgtccgggccattgactatgacccactggacaagcaactctattggattgactcacgacaaaacatgatccgaaaggcacaagaagatggcagccagggctttactgtggttgtgagctcagttccgagtcagaacctggaaatacaaccctatgacctcagcattgatatttacagccgctacatctactggacttgtgaggctaccaatgtcattaatgtgacaagattagatgggagatcagttggagtggtgctgaaaggcgagcaggacagacctcgagccgttgtggtaaacccagagaaagggtatatgtattttaccaatcttcaggaaaggtctcctaaaattgaacgggctgctttggatgggacagaacgggaggtcctctttttcagtggcttaagtaaaccaattgctttagcccttgatagcaggctgggcaagctcttttgggctgattcagatctccggcgaattgaaagcagtgatctctcaggtgctaaccggatagtattagaagactccaatatcttgcagcctgtgggacttactgtgtttgaaaactggctctattggattgataaacagcagcaaatgattgaaaaaattgacatgacaggtcgagagggtagaaccaaagtccaagctcgaattgcccagcttagtgacattcatgcagtaaaggagctgaaccttcaagaatacagacagcacccttgtgctcaggataatggtggctgttcacatatttgtcttgtaaagggggatggtactacaaggtgttcttgccccatgcacctggttctacttcaagatgagctatcatgtggagaacctccaacatgttctcctcagcagtttacttgtttcacgggggaaattgactgtatccctgtggcttggcggtgcgatgggtttactgaatgtgaagaccacagtgatgaactcaattgtcctgtatgctcagagtcccagttccagtgtgccagtgggcagtgtattgatggtgccctccgatgcaatggagatgcaaactgccaggacaaatcagatgagaagaactgtgaagtgctttgtttaattgatcagttccgctgtgccaatggtcagtgcattggaaagcacaagaagtgtgatcataatgtggattgcagtgacaagtcagatgaactggattgttatccgactgaagaaccagcaccacaggccaccaatacagttggttctgttattggcgtaattgtcaccatttttgtgtctggaactgtatactttatctgccagaggatgttgtgtccacgtatgaagggagatggggaaactatgactaatgactatgtagttcatggaccagcttctgtgcctcttggttatgtgccacacccaagttctttgtcaggatctcttccaggaatgtctcgaggtaaatcaatgatcagctccctcagtatcatggggggaagcagtggacccccctatgaccgagcccatgttacaggagcatcatcaagtagttcttcaagcaccaaaggcacttacttccctgcaattttgaaccctccaccatccccagccacagagcgatcacattacactatggaatttggatattcttcaaacagtccttccactcataggtcatacagctacaggccatatagctaccggcactttgcaccccccaccacaccctgcagcacagatgtttgtgacagtgactatgctcctagtcggagaatgacctcagtggcaacagccaagggctataccagtgacttgaactatgattcagaacctgtgcccccacctcccacaccccgaagccaatacttgtcagcagaggagaactatgaaagctgcccaccttctccatacacagagaggagctattctcatcacctctacccaccgccaccctctccctgtacagactcctcctga
Sequence Length
4842
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
180,429 Da
NCBI Official Full Name
Homo sapiens low density lipoprotein receptor-related protein 6, mRNA
NCBI Official Synonym Full Names
LDL receptor related protein 6
NCBI Official Symbol
LRP6
NCBI Official Synonym Symbols
ADCAD2; STHAG7
NCBI Protein Information
low-density lipoprotein receptor-related protein 6
UniProt Protein Name
Low-density lipoprotein receptor-related protein 6
UniProt Gene Name
LRP6
UniProt Synonym Gene Names
LRP-6
UniProt Entry Name
LRP6_HUMAN

NCBI Description

This gene encodes a member of the low density lipoprotein (LDL) receptor gene family. LDL receptors are transmembrane cell surface proteins involved in receptor-mediated endocytosis of lipoprotein and protein ligands. The protein encoded by this gene functions as a receptor or, with Frizzled, a co-receptor for Wnt and thereby transmits the canonical Wnt/beta-catenin signaling cascade. Through its interaction with the Wnt/beta-catenin signaling cascade this gene plays a role in the regulation of cell differentiation, proliferation, and migration and the development of many cancer types. This protein undergoes gamma-secretase dependent RIP- (regulated intramembrane proteolysis) processing but the precise locations of the cleavage sites have not been determined.[provided by RefSeq, Dec 2009]

Uniprot Description

LRP6: Component of the Wnt-Fzd-LRP5-LRP6 complex that triggers beta-catenin signaling through inducing aggregation of receptor- ligand complexes into ribosome-sized signalsomes. Cell-surface coreceptor of Wnt/beta-catenin signaling, which plays a pivotal role in bone formation. The Wnt-induced Fzd/LRP6 coreceptor complex recruits DVL1 polymers to the plasma membrane which, in turn, recruits the AXIN1/GSK3B-complex to the cell surface promoting the formation of signalsomes and inhibiting AXIN1/GSK3- mediated phosphorylation and destruction of beta-catenin. Required for posterior patterning of the epiblast during gastrulation. Homodimer; disulfide-linked. Forms phosphorylated oligomer aggregates on Wnt-signaling. Forms a WNT-signaling complex formed of a WNT protein, a FZD protein and LRP5 or LRP6. Interacts (via the extracellular domain) with WNT1; the interaction is enhanced by prior formation of the Wnt/Fzd complex. Interacts (via the beta-propeller regions 3 and 4) with WNT3A. Interacts (via the beta-propeller regions 1 and 2) with WNT9B. Interacts with FZD5; the interaction forms a coreceptor complex for Wnt signaling and is inhibited by DKK1 and C1orf187. Interacts (via beta propeller region) with DKK1; the interaction inhibits FZD5/LRP6 complex formation. Interacts with DKK2. Interacts with C1orf187/DRAXIN; the interaction inhibits Wnt signaling. Interacts (via the phosphorylated PPPSP motifs) with AXIN1; the interaction recruits the AXIN1/GSK3B complex to cell surface LRP6 signalsomes. Interacts with GRB10; the interaction prevents AXIN1 binding, thus negatively regulating the Wnt signaling pathway. Interacts (via the extracellular domain) with RSPO1; the interaction activates Wnt/beta-catenin signaling. Interacts (via the extracellular domain) with RSPO3 (via the cysteine rich domain); the interaction activates Wnt/beta-catenin signaling. Interacts (via the beta- propeller regions 1 and 2) with SOST; the interaction competes with DKK1 for binding for inhibiting beta-catenin signaling. Interacts with MESD; the interaction prevents the formation of LRP6 aggregates and targets LRP6 to the plasma membrane. Interacts (via the cytoplasmic domain) with CSNKIE; the interaction phosphorylates LRP6, binds AXIN1 and inhibits AXIN1/GSK3B-mediated phosphorylation of beta-catenin. Interacts with MACF1. Decreased levels on WNT3A stimulation. Widely co-expressed with LRP5 during embryogenesis and in adult tissues. Belongs to the LDLR family.

Protein type: Membrane protein, integral; Receptor, misc.

Chromosomal Location of Human Ortholog: 12p13.2

Cellular Component: caveola; cell soma; cell surface; cytoplasmic vesicle; early endosome; early endosome membrane; extracellular region; Golgi apparatus; plasma membrane; receptor complex; synapse

Molecular Function: apolipoprotein binding; frizzled binding; identical protein binding; kinase inhibitor activity; low-density lipoprotein receptor activity; protein binding; protein homodimerization activity; receptor binding; toxin transporter activity; Wnt receptor activity; Wnt-protein binding

Biological Process: cerebellum morphogenesis; cerebral cortex development; convergent extension; embryonic pattern specification; embryonic retina morphogenesis in camera-type eye; external genitalia morphogenesis; midbrain-hindbrain boundary development; negative regulation of protein amino acid phosphorylation; negative regulation of protein kinase activity; neural crest cell differentiation; neural crest formation; neural tube closure; odontogenesis of dentine-containing teeth; palate development; positive regulation of cell cycle; positive regulation of transcription factor activity; positive regulation of transcription from RNA polymerase II promoter; positive regulation of transcription, DNA-dependent; synaptic transmission; thalamus development; Wnt receptor signaling pathway; Wnt receptor signaling pathway through beta-catenin

Disease: Coronary Artery Disease, Autosomal Dominant 2; Tooth Agenesis, Selective, 7

Research Articles on LRP6

Similar Products

Product Notes

The LRP6 lrp6 (Catalog #AAA1266721) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggggccg tcctgaggag cctcctggcc tgcagcttct gtgtgctcct gagagcggcc cctttgttgc tttatgcaaa cagacgggac ttgcgattgg ttgatgctac aaatggcaaa gagaatgcta cgattgtagt tggaggcttg gaggatgcag ctgcggtgga ctttgtgttt agtcatggct tgatatactg gagtgatgtc agcgaagaag ccattaaacg aacagaattt aacaaaactg agagtgtgca gaatgttgtt gtttctggat tattgtcccc cgatgggctg gcatgtgatt ggcttggaga aaaattgtac tggacagatt ctgaaactaa tcggattgaa gtttctaatt tagatggatc tttacgaaaa gttttatttt ggcaagagtt ggatcaaccc agagctattg ccttagatcc ttcaagtggg ttcatgtact ggacagactg gggagaagtg ccaaagatag aacgtgctgg aatggatggt tcaagtcgct tcattataat aaacagtgaa atttactggc caaatggact gactttggat tatgaagaac aaaagcttta ttgggcagat gcaaaactta atttcatcca caaatcaaat ctggatggaa caaatcggca ggcagtggtt aaaggttccc ttccacatcc ttttgccttg acgttatttg aggacatatt gtactggact gactggagca cacactccat tttggcttgc aacaagtata ctggtgaggg tctgcgtgaa atccattctg acatcttctc tcccatggat atacatgcct tcagccaaca gaggcagcca aatgccacaa atccatgtgg aattgacaat gggggttgtt cccatttgtg tttgatgtct ccagtcaagc ctttttatca gtgtgcttgc cccactgggg tcaaactcct ggagaatgga aaaacctgca aagatggtgc cacagaatta ttgcttttag ctcgaaggac agacttgaga cgcatttctt tggatacacc agattttaca gacattgttc tgcagttaga agacatccgt catgccattg ccatagatta cgatcctgtg gaaggctaca tctactggac tgatgatgaa gtgagggcca tacgccgttc atttatagat ggatctggca gtcagtttgt ggtcactgct caaattgccc atcctgatgg tattgctgtg gactgggttg cacgaaatct ttattggaca gacactggca ctgatcgaat agaagtgaca aggctcaatg ggaccatgag gaagatcttg atttcagagg acttagagga accccgggct attgtgttag atcccatggt tgggtacatg tattggactg actggggaga aattccgaaa attgagcgag cagctctgga tggttctgac cgtgtagtat tggttaacac ttctcttggt tggccaaatg gtttagcctt ggattatgat gaaggcaaaa tatactgggg agatgccaaa acagacaaga ttgaggttat gaatactgat ggcactggga gacgagtact agtggaagac aaaattcctc acatatttgg atttactttg ttgggtgact atgtttactg gactgactgg cagaggcgta gcattgaaag agttcataaa cgaagtgcag agagggaagt gatcatagat cagctgcctg acctcatggg cctaaaggct acaaatgttc atcgagtgat tggttccaac ccctgtgctg aggaaaacgg gggatgtagc catctctgcc tctatagacc tcagggcctt cgctgtgctt gccctattgg ctttgaactc atcagtgaca tgaagacctg cattgtccca gaggctttcc ttttgttttc acggagagca gatatcagac gaatttctct ggaaacaaac aataataatg tggctattcc actcactggt gtcaaagaag cttctgcttt ggattttgat gtgacagaca accgaattta ttggactgat atatcactca agaccatcag cagagccttt atgaatggca gtgcactgga acatgtggta gaattcggct tagattatcc agaaggcatg gcagtagact ggcttgggaa gaacttgtac tgggcagaca caggaacgaa tcgaattgag gtgtcaaagt tggatgggca gcaccgacaa gttttggtgt ggaaagacct agatagtccc agagctctcg cgttggaccc tgccgaagga tttatgtatt ggactgaatg gggtggaaaa cctaagatag acagagctgc aatggatgga agtgaacgta ctaccttagt tccaaatgtg gggcgggcaa acggcctaac tattgattat gctaaaagga ggctttattg gacagacctg gacaccaact taatagaatc ttcaaatatg cttgggctca accgtgaagt tatagcagat gacttgcctc atccttttgg cttaactcag taccaagatt atatctactg gacggactgg agccgacgca gcattgagcg tgccaacaaa accagtggcc aaaaccgcac catcattcag ggccatttgg attatgtgat ggacatcctc gtctttcact catctcgaca gtcagggtgg aatgaatgtg cttccagcaa tgggcactgc tcccacctct gcttggctgt gccagttggg ggttttgttt gtggatgccc tgcccactac tctcttaatg ctgacaacag gacttgtagt gctcctacga ctttcctgct cttcagtcaa aagagtgcca tcaaccgcat ggtgattgat gaacaacaga gccccgacat catccttccc atccacagcc ttcggaatgt ccgggccatt gactatgacc cactggacaa gcaactctat tggattgact cacgacaaaa catgatccga aaggcacaag aagatggcag ccagggcttt actgtggttg tgagctcagt tccgagtcag aacctggaaa tacaacccta tgacctcagc attgatattt acagccgcta catctactgg acttgtgagg ctaccaatgt cattaatgtg acaagattag atgggagatc agttggagtg gtgctgaaag gcgagcagga cagacctcga gccgttgtgg taaacccaga gaaagggtat atgtatttta ccaatcttca ggaaaggtct cctaaaattg aacgggctgc tttggatggg acagaacggg aggtcctctt tttcagtggc ttaagtaaac caattgcttt agcccttgat agcaggctgg gcaagctctt ttgggctgat tcagatctcc ggcgaattga aagcagtgat ctctcaggtg ctaaccggat agtattagaa gactccaata tcttgcagcc tgtgggactt actgtgtttg aaaactggct ctattggatt gataaacagc agcaaatgat tgaaaaaatt gacatgacag gtcgagaggg tagaaccaaa gtccaagctc gaattgccca gcttagtgac attcatgcag taaaggagct gaaccttcaa gaatacagac agcacccttg tgctcaggat aatggtggct gttcacatat ttgtcttgta aagggggatg gtactacaag gtgttcttgc cccatgcacc tggttctact tcaagatgag ctatcatgtg gagaacctcc aacatgttct cctcagcagt ttacttgttt cacgggggaa attgactgta tccctgtggc ttggcggtgc gatgggttta ctgaatgtga agaccacagt gatgaactca attgtcctgt atgctcagag tcccagttcc agtgtgccag tgggcagtgt attgatggtg ccctccgatg caatggagat gcaaactgcc aggacaaatc agatgagaag aactgtgaag tgctttgttt aattgatcag ttccgctgtg ccaatggtca gtgcattgga aagcacaaga agtgtgatca taatgtggat tgcagtgaca agtcagatga actggattgt tatccgactg aagaaccagc accacaggcc accaatacag ttggttctgt tattggcgta attgtcacca tttttgtgtc tggaactgta tactttatct gccagaggat gttgtgtcca cgtatgaagg gagatgggga aactatgact aatgactatg tagttcatgg accagcttct gtgcctcttg gttatgtgcc acacccaagt tctttgtcag gatctcttcc aggaatgtct cgaggtaaat caatgatcag ctccctcagt atcatggggg gaagcagtgg acccccctat gaccgagccc atgttacagg agcatcatca agtagttctt caagcaccaa aggcacttac ttccctgcaa ttttgaaccc tccaccatcc ccagccacag agcgatcaca ttacactatg gaatttggat attcttcaaa cagtccttcc actcataggt catacagcta caggccatat agctaccggc actttgcacc ccccaccaca ccctgcagca cagatgtttg tgacagtgac tatgctccta gtcggagaat gacctcagtg gcaacagcca agggctatac cagtgacttg aactatgatt cagaacctgt gcccccacct cccacacccc gaagccaata cttgtcagca gaggagaact atgaaagctg cccaccttct ccatacacag agaggagcta ttctcatcac ctctacccac cgccaccctc tccctgtaca gactcctcct ga. It is sometimes possible for the material contained within the vial of "LRP6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.