Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LPAR3 cdna clone

LPAR3 cDNA Clone

Gene Names
LPAR3; EDG7; GPCR; LPA3; Edg-7; LP-A3; HOFNH30; RP4-678I3
Synonyms
LPAR3; LPAR3 cDNA Clone; LPAR3 cdna clone
Ordering
For Research Use Only!
Sequence
atgaatgagtgtcactatgacaagcacatggactttttttataataggagcaacactgatactgtcgatgactggacaggaacaaagcttgtgattgttttgtgtgttgggacgtttttctgcctgtttatttttttttctaattctctggtcatcgcggcagtgatcaaaaacagaaaatttcatttccccttctactacctgttggctaatttagctgctgccgatttcttcgctggaattgcctatgtattcctgatgtttaacacaggcccagtttcaaaaactttgactgtcaaccgctggtttctccgtcaggggcttctggacagtagcttgactgcttccctcaccaacttgctggttatcgccgtggagaggcacatgtcaatcatgaggatgcgggtccatagcaacctgaccaaaaagagggtgacactgctcattttgcttgtctgggccatcgccatttttatgggggcggtccccacactgggctggaattgcctctgcaacatctctgcctgctcttccctggcccccatttacagcaggagttaccttgttttctggacagtgtccaacctcatggccttcctcatcatggttgtggtgtacctgcggatctacgtgtacgtcaagaggaaaaccaacgtcttgtctccgcatacaagtgggtccatcagccgccggaggacacccatgaagctaatgaagacggtgatgactgtcttaggggcgtttgtggtatgctggaccccgggcctggtggttctgctcctcgacggcctgaactgcaggcagtgtggcgtgcagcatgtgaaaaggtggttcctgctgctggcgctgctcaactccgtcgtgaaccccatcatctactcctacaaggacgaggacatgtatggcaccatgaagaagatgatctgctgcttctctcaggagaacccagagaggcgtccctctcgcatcccctccacagtcctcagcaggagtgacacaggcagccagtacatagaggatagtattagccaaggtgcagtctgcaataaaagcacttcctaa
Sequence Length
1062
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
40,128 Da
NCBI Official Full Name
Homo sapiens lysophosphatidic acid receptor 3, mRNA
NCBI Official Synonym Full Names
lysophosphatidic acid receptor 3
NCBI Official Symbol
LPAR3
NCBI Official Synonym Symbols
EDG7; GPCR; LPA3; Edg-7; LP-A3; HOFNH30; RP4-678I3
NCBI Protein Information
lysophosphatidic acid receptor 3
UniProt Protein Name
Lysophosphatidic acid receptor 3
UniProt Gene Name
LPAR3
UniProt Synonym Gene Names
EDG7; LPA3; LPA receptor 3; LPA-3
UniProt Entry Name
LPAR3_HUMAN

NCBI Description

This gene encodes a member of the G protein-coupled receptor family, as well as the EDG family of proteins. This protein functions as a cellular receptor for lysophosphatidic acid and mediates lysophosphatidic acid-evoked calcium mobilization. This receptor couples predominantly to G(q/11) alpha proteins. [provided by RefSeq, Jul 2008]

Uniprot Description

EDG7: Receptor for lysophosphatidic acid (LPA), a mediator of diverse cellular activities. May play a role in the development of ovarian cancer. Seems to be coupled to the G(i)/G(o) and G(q) families of heteromeric G proteins. Belongs to the G-protein coupled receptor 1 family.

Protein type: Membrane protein, multi-pass; Motility/polarity/chemotaxis; GPCR, family 1; Receptor, GPCR; Membrane protein, integral

Chromosomal Location of Human Ortholog: 1p22.3

Cellular Component: integral to plasma membrane; plasma membrane

Molecular Function: G-protein coupled receptor activity; lipid binding

Biological Process: elevation of cytosolic calcium ion concentration; G-protein signaling, coupled to cyclic nucleotide second messenger; synaptic transmission

Research Articles on LPAR3

Similar Products

Product Notes

The LPAR3 lpar3 (Catalog #AAA1275168) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaatgagt gtcactatga caagcacatg gacttttttt ataataggag caacactgat actgtcgatg actggacagg aacaaagctt gtgattgttt tgtgtgttgg gacgtttttc tgcctgttta tttttttttc taattctctg gtcatcgcgg cagtgatcaa aaacagaaaa tttcatttcc ccttctacta cctgttggct aatttagctg ctgccgattt cttcgctgga attgcctatg tattcctgat gtttaacaca ggcccagttt caaaaacttt gactgtcaac cgctggtttc tccgtcaggg gcttctggac agtagcttga ctgcttccct caccaacttg ctggttatcg ccgtggagag gcacatgtca atcatgagga tgcgggtcca tagcaacctg accaaaaaga gggtgacact gctcattttg cttgtctggg ccatcgccat ttttatgggg gcggtcccca cactgggctg gaattgcctc tgcaacatct ctgcctgctc ttccctggcc cccatttaca gcaggagtta ccttgttttc tggacagtgt ccaacctcat ggccttcctc atcatggttg tggtgtacct gcggatctac gtgtacgtca agaggaaaac caacgtcttg tctccgcata caagtgggtc catcagccgc cggaggacac ccatgaagct aatgaagacg gtgatgactg tcttaggggc gtttgtggta tgctggaccc cgggcctggt ggttctgctc ctcgacggcc tgaactgcag gcagtgtggc gtgcagcatg tgaaaaggtg gttcctgctg ctggcgctgc tcaactccgt cgtgaacccc atcatctact cctacaagga cgaggacatg tatggcacca tgaagaagat gatctgctgc ttctctcagg agaacccaga gaggcgtccc tctcgcatcc cctccacagt cctcagcagg agtgacacag gcagccagta catagaggat agtattagcc aaggtgcagt ctgcaataaa agcacttcct aa. It is sometimes possible for the material contained within the vial of "LPAR3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.