Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LPAR2 cdna clone

LPAR2 cDNA Clone

Gene Names
LPAR2; EDG4; LPA2; EDG-4; LPA-2
Synonyms
LPAR2; LPAR2 cDNA Clone; LPAR2 cdna clone
Ordering
For Research Use Only!
Sequence
atggtcatcatgggccagtgctactacaacgagaccatcggcttcttctataacaacagtggcaaagagctcagctcccactggcggcccaaggatgtggtcgtggtggcactggggctgaccgtcagcgtgctggtgctgctgaccaatctgctggtcatagcagccatcgcctccaaccgccgcttccaccagcccatctactacctgctcggcaatctggccgcggctgacctcttcgcgggcgtggcctacctcttcctcatgttccacactggtccccgcacagcccgactttcacttgagggctggttcctgcggcagggcttgctggacacaagcctcactgcgtcggtggccacactgctggccatcgccgtggagcggcaccgcagtgtgatggccgtgcagctgcacagccgcctgccccgtggccgcgtggtcatgctcattgtgggcgtgtgggtggctgccctgggcctggggctgctgcctgcccactcctggcactgcctctgtgccctggaccgctgctcacgcatggcacccctgctcagccgctcctatttggccgtctgggctctgtcgagcctgcttgtcttcctgctcatggtggctgtgtacacccgcattttcttctacgtgcggcggcgagtgcagcgcatggcagagcatgtcagctgccacccccgctaccgagagaccacgctcagcctggtcaagactgttgtcatcatcctgggggcgttcgtggtctgctggacaccaggccaggtggtactgctcctggatggtttaggctgtgagtcctgcaatgtcctggctgtagaaaagtacttcctactgttggccgaggccaactcactggtcaatgctgctgtgtactcttgccgagatgctgagatgcgccgcaccttccgccgccttctctgctgcgcgtgcctccgccagtccacccgcgagtctgtccactatacatcctctgcccagggaggtgccagcactcgcatcatgcttcccgagaacggccacccactgatggactccaccctttag
Sequence Length
1056
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
39,084 Da
NCBI Official Full Name
Homo sapiens lysophosphatidic acid receptor 2, mRNA
NCBI Official Synonym Full Names
lysophosphatidic acid receptor 2
NCBI Official Symbol
LPAR2
NCBI Official Synonym Symbols
EDG4; LPA2; EDG-4; LPA-2
NCBI Protein Information
lysophosphatidic acid receptor 2
UniProt Protein Name
Lysophosphatidic acid receptor 2
UniProt Gene Name
LPAR2
UniProt Synonym Gene Names
EDG4; LPA2; LPA receptor 2; LPA-2
UniProt Entry Name
LPAR2_HUMAN

NCBI Description

This gene encodes a member of family I of the G protein-coupled receptors, as well as the EDG family of proteins. This protein functions as a lysophosphatidic acid (LPA) receptor and contributes to Ca2+ mobilization, a critical cellular response to LPA in cells, through association with Gi and Gq proteins. An alternative splice variant has been described but its full length sequence has not been determined. [provided by RefSeq, Jul 2008]

Uniprot Description

EDG4: Receptor for lysophosphatidic acid (LPA), a mediator of diverse cellular activities. Seems to be coupled to the G(i)/G(o), G(12)/G(13), and G(q) families of heteromeric G proteins. Plays a key role in phospholipase C-beta (PLC-beta) signaling pathway. Stimulates phospholipase C (PLC) activity in a manner that is independent of RALA activation. Belongs to the G-protein coupled receptor 1 family.

Protein type: Receptor, GPCR; Membrane protein, integral; GPCR, family 1; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 19p12

Cellular Component: cell surface; endocytic vesicle; integral to plasma membrane; plasma membrane

Molecular Function: G-protein coupled receptor activity; lipid binding; protein binding

Biological Process: elevation of cytosolic calcium ion concentration; phospholipase C activation

Research Articles on LPAR2

Similar Products

Product Notes

The LPAR2 lpar2 (Catalog #AAA1266278) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtcatca tgggccagtg ctactacaac gagaccatcg gcttcttcta taacaacagt ggcaaagagc tcagctccca ctggcggccc aaggatgtgg tcgtggtggc actggggctg accgtcagcg tgctggtgct gctgaccaat ctgctggtca tagcagccat cgcctccaac cgccgcttcc accagcccat ctactacctg ctcggcaatc tggccgcggc tgacctcttc gcgggcgtgg cctacctctt cctcatgttc cacactggtc cccgcacagc ccgactttca cttgagggct ggttcctgcg gcagggcttg ctggacacaa gcctcactgc gtcggtggcc acactgctgg ccatcgccgt ggagcggcac cgcagtgtga tggccgtgca gctgcacagc cgcctgcccc gtggccgcgt ggtcatgctc attgtgggcg tgtgggtggc tgccctgggc ctggggctgc tgcctgccca ctcctggcac tgcctctgtg ccctggaccg ctgctcacgc atggcacccc tgctcagccg ctcctatttg gccgtctggg ctctgtcgag cctgcttgtc ttcctgctca tggtggctgt gtacacccgc attttcttct acgtgcggcg gcgagtgcag cgcatggcag agcatgtcag ctgccacccc cgctaccgag agaccacgct cagcctggtc aagactgttg tcatcatcct gggggcgttc gtggtctgct ggacaccagg ccaggtggta ctgctcctgg atggtttagg ctgtgagtcc tgcaatgtcc tggctgtaga aaagtacttc ctactgttgg ccgaggccaa ctcactggtc aatgctgctg tgtactcttg ccgagatgct gagatgcgcc gcaccttccg ccgccttctc tgctgcgcgt gcctccgcca gtccacccgc gagtctgtcc actatacatc ctctgcccag ggaggtgcca gcactcgcat catgcttccc gagaacggcc acccactgat ggactccacc ctttag. It is sometimes possible for the material contained within the vial of "LPAR2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.