Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LPAL2 cdna clone

LPAL2 cDNA Clone

Gene Names
LPAL2; APOA2; APOAL; APOARGC; apo(a)rg-C
Synonyms
LPAL2; LPAL2 cDNA Clone; LPAL2 cdna clone
Ordering
For Research Use Only!
Sequence
ATGGAACATAAGGAAGTGGTTCTTCTACTTCTGTTATTTCTGAAATCAGCACCGACTGAGACAGGGCCTTCTGTGCAGGAGTGCTACCACAGTAATGGACAGAGTTATCGAGGCACATACTTCACCACTGTCACAGGAAGAACCTGCCAAGCTTGGTCATCTATGACGCCACACCAGCACAGTAGAACCCCAGAAAAGTACCCAAATGATGGCTTGATCTCGAACTACTGCAGGAATCCGGATTGTTCGGCAGGCCCTTGGTGTTATACGACGGATCCCAATGTCAGGTGGGAGTACTGCAACCTGACACGGTGCTCAGACGATGAAGGGACTGTGTTCGTGCCTCTGACTGTTATCCCAGTTCCAAGCCTAGAGGATTCATTCATACAAGTGGCTTGA
Sequence Length
399
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
14,886 Da
NCBI Official Full Name
Homo sapiens lipoprotein, Lp(a)-like 2, mRNA
NCBI Official Synonym Full Names
lipoprotein(a) like 2, pseudogene
NCBI Official Symbol
LPAL2
NCBI Official Synonym Symbols
APOA2; APOAL; APOARGC; apo(a)rg-C
UniProt Protein Name
Putative apolipoprotein(a)-like protein 2
UniProt Gene Name
LPAL2
UniProt Synonym Gene Names
APOARGC; Apo(a)-like protein 2; Lp(a)-liker protein 2; Apo(a)rg-C
UniProt Entry Name
LPAL2_HUMAN

NCBI Description

Apolipoprotein(a) is the distinguishing protein moiety of lipoprotein(a), of which elevated plasma levels are correlated with an increased risk of atherosclerosis. This gene is similar to the lipoprotein, Lp(a) gene, but all transcripts produced by this gene contain a truncated open reading frame and are candidates for nonsense-mediated decay. Consequently, this gene is considered to be a pseudogene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2009]

Uniprot Description

LPAL2:

Protein type: Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 6q26-q27

Molecular Function: protein binding

Research Articles on LPAL2

Similar Products

Product Notes

The LPAL2 lpal2 (Catalog #AAA1276693) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGGAACATA AGGAAGTGGT TCTTCTACTT CTGTTATTTC TGAAATCAGC ACCGACTGAG ACAGGGCCTT CTGTGCAGGA GTGCTACCAC AGTAATGGAC AGAGTTATCG AGGCACATAC TTCACCACTG TCACAGGAAG AACCTGCCAA GCTTGGTCAT CTATGACGCC ACACCAGCAC AGTAGAACCC CAGAAAAGTA CCCAAATGAT GGCTTGATCT CGAACTACTG CAGGAATCCG GATTGTTCGG CAGGCCCTTG GTGTTATACG ACGGATCCCA ATGTCAGGTG GGAGTACTGC AACCTGACAC GGTGCTCAGA CGATGAAGGG ACTGTGTTCG TGCCTCTGAC TGTTATCCCA GTTCCAAGCC TAGAGGATTC ATTCATACAA GTGGCTTGA. It is sometimes possible for the material contained within the vial of "LPAL2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.