Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LNX1 cdna clone

LNX1 cDNA Clone

Gene Names
LNX1; LNX; MPDZ; PDZRN2
Synonyms
LNX1; LNX1 cDNA Clone; LNX1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaaccagccagagtctgccaacgatcctgaacccctgtgtgcagtgtgtggccaagcccactccttggaggaaaaccacttctacagctatccagaggaagtggatgatgacctcatctgccacatctgcctgcaggctttgctggaccccctggacactccgtgtggacacacctactgcaccctctgcctcaccaacttcctggtggagaaggacttctgtcccatggaccgcaagcctctggttctgcagcactgcaagaagtccagcatcctggtcaacaaactcctcaacaagctactggtgacctgcccattcagggagcactgcacccaggtgttgcagcgctgtgacctcgagcatcactttcaaaccagctgtaaaggtgcctcccactacggcctgaccaaagataggaagaggcgctcacaagatggctgtccagacggctgtgcgagcctcacagccacggctccctccccagaggtttctgcagctgccaccatctccttaatgacagacgagcctggcctagacaaccctgcctacgtgtcctcggcagaggacgggcagccagcaatcagcccagtggactctggccggagcaaccgaactagggcacggccctttgagagatccactattagaagcagatcatttaaaaaaataaatcgagctttgagtgttcttcgaaggacaaagagcgggagtgcagttgccaaccatgccgaccagggcagggaaaattctgaaaacaccactgcccctgaagtctttccaaggttgtaccacctgattccagatggtgaaattaccagcatcaagatcaatcgagtagatcccagtgaaagcctctctattaggctggtgggaggtagcgaaaccccactggtccatatcattatccaacacatttatcgtgatggggtgatcgccagagacggccggctactgccaggagacatcattctaaaggtcaacgggatggacatcagcaatgtccctcacaactacgctgtgcgtctcctgcggcagccctgccaggtgctgtggctgactgtgatgcgtgaacagaagttccgcagcaggaacaatggacaggccccggatgcctacagaccccgagatgacagctttcatgtgattctcaacaaaagtagccccgaggagcagcttggaataaaactggtgcgcaaggtggatgagcctggggttttcatcttcaatgtgctggatggcggtgtggcatatcgacatggtcagcttgaggagaatgaccgtgtgttagccatcaatggacatgatcttcgatatggcagcccagaaagtgcggctcatctgattcaggccagtgaaagacgtgttcacctcgtcgtgtcccgccaggttcggcagcggagccctgacatctttcaggaagccggctggaacagcaatggcagctggtccccagggccaggggagaggagcaacactcccaagcccctccatcctacaattacttgtcatgagaaggtggtaaatatccaaaaagaccccggtgaatctctcggcatgaccgtcgcagggggagcatcacatagagaatgggatttgcctatctatgtcatcagtgttgagcccggaggagtcataagcagagatggaagaataaaaacaggtgacattttgttgaatgtggatggggtcgaactgacagaggtcagccggagtgaggcagtggcattattgaaaagaacatcatcctcgatagtactcaaagctttggaagtcaaagagtatgagccccaggaagactgcagcagcccagcagccctggactccaaccacaacatggccccacccagtgactggtccccatcctgggtcatgtggctggaattaccacggtgcttgtataactgtaaagatattgtattacgaagaaacacagctggaagtctgggcttctgcattgtaggaggttatgaagaatacaatggaaacaaaccttttttcatcaaatccattgttgaaggaacaccagcatacaatgatggaagaattagatgtggtgatattcttcttgctgtcaatggtagaagtacatcaggaatgatacatgcttgcttggcaagactgctgaaagaacttaaaggaagaattactctaactattgtttcttggcctggcacttttttatag
Sequence Length
2187
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
69,643 Da
NCBI Official Full Name
Homo sapiens ligand of numb-protein X 1, mRNA
NCBI Official Synonym Full Names
ligand of numb-protein X 1
NCBI Official Symbol
LNX1
NCBI Official Synonym Symbols
LNX; MPDZ; PDZRN2
NCBI Protein Information
E3 ubiquitin-protein ligase LNX
UniProt Protein Name
E3 ubiquitin-protein ligase LNX
UniProt Gene Name
LNX1
UniProt Synonym Gene Names
LNX; PDZRN2
UniProt Entry Name
LNX1_HUMAN

NCBI Description

This gene encodes a membrane-bound protein that is involved in signal transduction and protein interactions. The encoded product is an E3 ubiquitin-protein ligase, which mediates ubiquitination and subsequent proteasomal degradation of proteins containing phosphotyrosine binding (PTB) domains. This protein may play an important role in tumorogenesis. Alternatively spliced transcript variants encoding distinct isoforms have been described. A pseudogene, which is located on chromosome 17, has been identified for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

LNX1: E3 ubiquitin-protein ligase that mediates ubiquitination and subsequent proteasomal degradation of NUMB. E3 ubiquitin ligases accept ubiquitin from an E2 ubiquitin-conjugating enzyme in the form of a thioester and then directly transfers the ubiquitin to targeted substrates. Mediates ubiquitination of isoform p66 and isoform p72 of NUMB, but not that of isoform p71 or isoform p65. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Ubiquitin conjugating system; Adaptor/scaffold; EC 6.3.2.-; Ligase; Ubiquitin ligase

Chromosomal Location of Human Ortholog: 4q12

Molecular Function: protein binding

Research Articles on LNX1

Similar Products

Product Notes

The LNX1 lnx1 (Catalog #AAA1268227) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaccagc cagagtctgc caacgatcct gaacccctgt gtgcagtgtg tggccaagcc cactccttgg aggaaaacca cttctacagc tatccagagg aagtggatga tgacctcatc tgccacatct gcctgcaggc tttgctggac cccctggaca ctccgtgtgg acacacctac tgcaccctct gcctcaccaa cttcctggtg gagaaggact tctgtcccat ggaccgcaag cctctggttc tgcagcactg caagaagtcc agcatcctgg tcaacaaact cctcaacaag ctactggtga cctgcccatt cagggagcac tgcacccagg tgttgcagcg ctgtgacctc gagcatcact ttcaaaccag ctgtaaaggt gcctcccact acggcctgac caaagatagg aagaggcgct cacaagatgg ctgtccagac ggctgtgcga gcctcacagc cacggctccc tccccagagg tttctgcagc tgccaccatc tccttaatga cagacgagcc tggcctagac aaccctgcct acgtgtcctc ggcagaggac gggcagccag caatcagccc agtggactct ggccggagca accgaactag ggcacggccc tttgagagat ccactattag aagcagatca tttaaaaaaa taaatcgagc tttgagtgtt cttcgaagga caaagagcgg gagtgcagtt gccaaccatg ccgaccaggg cagggaaaat tctgaaaaca ccactgcccc tgaagtcttt ccaaggttgt accacctgat tccagatggt gaaattacca gcatcaagat caatcgagta gatcccagtg aaagcctctc tattaggctg gtgggaggta gcgaaacccc actggtccat atcattatcc aacacattta tcgtgatggg gtgatcgcca gagacggccg gctactgcca ggagacatca ttctaaaggt caacgggatg gacatcagca atgtccctca caactacgct gtgcgtctcc tgcggcagcc ctgccaggtg ctgtggctga ctgtgatgcg tgaacagaag ttccgcagca ggaacaatgg acaggccccg gatgcctaca gaccccgaga tgacagcttt catgtgattc tcaacaaaag tagccccgag gagcagcttg gaataaaact ggtgcgcaag gtggatgagc ctggggtttt catcttcaat gtgctggatg gcggtgtggc atatcgacat ggtcagcttg aggagaatga ccgtgtgtta gccatcaatg gacatgatct tcgatatggc agcccagaaa gtgcggctca tctgattcag gccagtgaaa gacgtgttca cctcgtcgtg tcccgccagg ttcggcagcg gagccctgac atctttcagg aagccggctg gaacagcaat ggcagctggt ccccagggcc aggggagagg agcaacactc ccaagcccct ccatcctaca attacttgtc atgagaaggt ggtaaatatc caaaaagacc ccggtgaatc tctcggcatg accgtcgcag ggggagcatc acatagagaa tgggatttgc ctatctatgt catcagtgtt gagcccggag gagtcataag cagagatgga agaataaaaa caggtgacat tttgttgaat gtggatgggg tcgaactgac agaggtcagc cggagtgagg cagtggcatt attgaaaaga acatcatcct cgatagtact caaagctttg gaagtcaaag agtatgagcc ccaggaagac tgcagcagcc cagcagccct ggactccaac cacaacatgg ccccacccag tgactggtcc ccatcctggg tcatgtggct ggaattacca cggtgcttgt ataactgtaa agatattgta ttacgaagaa acacagctgg aagtctgggc ttctgcattg taggaggtta tgaagaatac aatggaaaca aacctttttt catcaaatcc attgttgaag gaacaccagc atacaatgat ggaagaatta gatgtggtga tattcttctt gctgtcaatg gtagaagtac atcaggaatg atacatgctt gcttggcaag actgctgaaa gaacttaaag gaagaattac tctaactatt gtttcttggc ctggcacttt tttatag. It is sometimes possible for the material contained within the vial of "LNX1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.