Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LMX1B cdna clone

LMX1B cDNA Clone

Gene Names
LMX1B; NPS1; LMX1.2
Synonyms
LMX1B; LMX1B cDNA Clone; LMX1B cdna clone
Ordering
For Research Use Only!
Sequence
atgttggacggcatcaagatggaggagcacgccctgcgccccgggcccgccactctgggggtgctgctgggctccgactgcccgcatcccgccgtctgcgagggctgccagcggcccatctccgaccgcttcctgatgcgagtcaacgagtcgtcctggcacgaggagtgtttgcagtgcgcggcgtgtcagcaagccctcaccaccagctgctacttccgggatcggaaactgtactgcaaacaagactaccaacagctcttcgcggccaagtgcagcggctgcatggagaagatcgcccccaccgagttcgtgatgcgggcgctggagtgcgtgtaccacctgggctgcttctgctgctgcgtgtgtgaacggcagctacgcaagggcgacgaattcgtgctcaaggagggccagctgctgtgcaagggtgactacgagaaggagaaggacctgctcagctccgtgagccccgacgagtccgactccgtgaagagcgaggatgaagatggggacatgaagccggccaaggggcagggcagtcagagcaagggcagcggggatgacgggaaggacccgcggaggcccaagcgaccccggaccatcctcaccacgcagcagcgaagagccttcaaggcctccttcgaggtctcgtcgaagccttgccgaaaggtccgagagacactggcagctgagacgggcctcagtgtgcgcgtggtccaggtctggtttcagaaccaaagagcaaagatgaagaagctggcgcggcggcaccagcagcagcaggagcagcagaactcccagcggctgggccaggaggtcctgtccagccgcatggagggcatgatggcttcctacacgccgctggccccaccacagcagcagatcgtggccatggaacagagcccctacggcagcagcgaccccttccagcagggcctcacgccgccccaaatgccagggaacgactccatcttccatgacatcgacagcgatacctccttaaccagcctcagcgactgcttcctcggctcctcagacgtgggctccctgcaggcccgcgtggggaaccccatcgaccggctctactccatgcagagttcctacttcgcctcctga
Sequence Length
1119
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
45,080 Da
NCBI Official Full Name
Homo sapiens LIM homeobox transcription factor 1, beta, mRNA
NCBI Official Synonym Full Names
LIM homeobox transcription factor 1 beta
NCBI Official Symbol
LMX1B
NCBI Official Synonym Symbols
NPS1; LMX1.2
NCBI Protein Information
LIM homeobox transcription factor 1-beta
UniProt Protein Name
LIM homeobox transcription factor 1-beta
Protein Family
UniProt Gene Name
LMX1B
UniProt Synonym Gene Names
LMX-1.2
UniProt Entry Name
LMX1B_HUMAN

NCBI Description

This gene encodes a member of LIM-homeodomain family of proteins containing two N-terminal zinc-binding LIM domains, 1 homeodomain, and a C-terminal glutamine-rich domain. It functions as a transcription factor, and is essential for the normal development of dorsal limb structures, the glomerular basement membrane, the anterior segment of the eye, and dopaminergic and serotonergic neurons. Mutations in this gene are associated with nail-patella syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]

Uniprot Description

LMX1B: Essential for the specification of dorsal limb fate at both the zeugopodal and autopodal levels. Defects in LMX1B are the cause of nail-patella syndrome (NPS); also known as onychoosteodysplasia. NPS is a disease that cause abnormal skeletal patterning and renal dysplasia. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: DNA-binding; Transcription factor; Cell development/differentiation

Chromosomal Location of Human Ortholog: 9q33.3

Cellular Component: nucleus

Molecular Function: protein binding; transcription factor activity

Biological Process: dorsal/ventral pattern formation; neuron differentiation; positive regulation of transcription from RNA polymerase II promoter; regulation of transcription, DNA-dependent

Disease: Nail-patella Syndrome

Research Articles on LMX1B

Similar Products

Product Notes

The LMX1B lmx1b (Catalog #AAA1267236) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttggacg gcatcaagat ggaggagcac gccctgcgcc ccgggcccgc cactctgggg gtgctgctgg gctccgactg cccgcatccc gccgtctgcg agggctgcca gcggcccatc tccgaccgct tcctgatgcg agtcaacgag tcgtcctggc acgaggagtg tttgcagtgc gcggcgtgtc agcaagccct caccaccagc tgctacttcc gggatcggaa actgtactgc aaacaagact accaacagct cttcgcggcc aagtgcagcg gctgcatgga gaagatcgcc cccaccgagt tcgtgatgcg ggcgctggag tgcgtgtacc acctgggctg cttctgctgc tgcgtgtgtg aacggcagct acgcaagggc gacgaattcg tgctcaagga gggccagctg ctgtgcaagg gtgactacga gaaggagaag gacctgctca gctccgtgag ccccgacgag tccgactccg tgaagagcga ggatgaagat ggggacatga agccggccaa ggggcagggc agtcagagca agggcagcgg ggatgacggg aaggacccgc ggaggcccaa gcgaccccgg accatcctca ccacgcagca gcgaagagcc ttcaaggcct ccttcgaggt ctcgtcgaag ccttgccgaa aggtccgaga gacactggca gctgagacgg gcctcagtgt gcgcgtggtc caggtctggt ttcagaacca aagagcaaag atgaagaagc tggcgcggcg gcaccagcag cagcaggagc agcagaactc ccagcggctg ggccaggagg tcctgtccag ccgcatggag ggcatgatgg cttcctacac gccgctggcc ccaccacagc agcagatcgt ggccatggaa cagagcccct acggcagcag cgaccccttc cagcagggcc tcacgccgcc ccaaatgcca gggaacgact ccatcttcca tgacatcgac agcgatacct ccttaaccag cctcagcgac tgcttcctcg gctcctcaga cgtgggctcc ctgcaggccc gcgtggggaa ccccatcgac cggctctact ccatgcagag ttcctacttc gcctcctga. It is sometimes possible for the material contained within the vial of "LMX1B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.