LMBR1L cdna clone
LMBR1L cDNA Clone
Gene Names
LMBR1L; LIMR
Synonyms
LMBR1L; LMBR1L cDNA Clone; LMBR1L cdna clone
Sequence
atggaagcacctgactacgaagtgctatccgtgcgagaacagctattccacgagaggatccgcgagtgtattatatcaacacttctgtttgcaacactgtacatcctctgccacatcttcctgacccgcttcaagaagcctgctgagttcaccacagtggatgatgaagatgccaccgtcaacaagattgcgctcgagctgtgcacctttaccctggcaattgccctgggtgctgtcctgctcctgcccttctccatcatcagcaatgaggtgctgctctccctgcctcggaactactacatccagtggctcaacggctccctcatccatggcctctggaaccttgtttttctcttctccaacctgtccctcatcttcctcatgccctttgcatatttcttcactgagtctgagggctttgctggctccagaaagggtgtcctgggccgggtctatgagacagtggtgatgttgatgctcctcactctgctggtgctaggtatggtgtgggtggcatcagccattgtggacaagaacaaggccaacagagagtcactctatgacttttgggagtactatctcccctacctctactcatgcatctccttccttggggttctgctgctcctggtgtgtactccactgggtctcgcccgcatgttctccgtcactgggaagctgctagtcaagccccggctgctggaagacctggaggagcagctgtactgctcagcctttgaggaggcagccctgacccgcaggatctgtaatcctacttcctgctggctgcctttagacatggagctgctacacagacaggtcctggctctgcagacacagagggtcctgctggagaagaggcggaaggcttcagcctggcaacggaacctgggctaccccctggctatgctgtgcttgctggtgctgacgggcctgtctgttctcattgtggccatccacatcctggagctgctcatcgatgaggctgccatgccccgaggcatgcagggtacctccttaggccaggtctccttctccaagctgggctcctttggtgccgtcattcaggttgtactcatcttttacctaatggtgtcctcagttgtgggcttctatagctctccactcttccggagcctgcggcccagatggcacgacactgccatgacgcagataattgggaactgtgtctgtctcctggtcctaagctcagcacttcctgtcttctctcgaaccctggggctcactcgctttgacctgctgggtgactttggacgcttcaactggctgggcaatttctacattgtgttcctctacaacgcagcctttgcaggcctcaccacactctgtctggtgaagaccttcactgcagctgtgcgggcagagctgatccgggcctttgggctggacagactgccgctgcccgtctccggtttcccccaggcatctaggaagacccagcaccagtga
Sequence Length
1470
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
44,358 Da
NCBI Official Full Name
Homo sapiens limb region 1 homolog (mouse)-like, mRNA
NCBI Official Synonym Full Names
limb development membrane protein 1 like
NCBI Official Symbol
LMBR1L
NCBI Official Synonym Symbols
LIMR
NCBI Protein Information
protein LMBR1L
UniProt Protein Name
Protein LMBR1L
Protein Family
UniProt Gene Name
LMBR1L
UniProt Synonym Gene Names
KIAA1174; LIMR; Lipocalin-interacting membrane receptor
UniProt Entry Name
LMBRL_HUMAN
Uniprot Description
LMBR1L: Probable LCN1 receptor. May mediate LCN1 endocytosis. Belongs to the LIMR family. 5 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, multi-pass; Membrane protein, integral
Chromosomal Location of Human Ortholog: 12q13.12
Research Articles on LMBR1L
Similar Products
Product Notes
The LMBR1L lmbr1l (Catalog #AAA1266023) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaagcac ctgactacga agtgctatcc gtgcgagaac agctattcca cgagaggatc cgcgagtgta ttatatcaac acttctgttt gcaacactgt acatcctctg ccacatcttc ctgacccgct tcaagaagcc tgctgagttc accacagtgg atgatgaaga tgccaccgtc aacaagattg cgctcgagct gtgcaccttt accctggcaa ttgccctggg tgctgtcctg ctcctgccct tctccatcat cagcaatgag gtgctgctct ccctgcctcg gaactactac atccagtggc tcaacggctc cctcatccat ggcctctgga accttgtttt tctcttctcc aacctgtccc tcatcttcct catgcccttt gcatatttct tcactgagtc tgagggcttt gctggctcca gaaagggtgt cctgggccgg gtctatgaga cagtggtgat gttgatgctc ctcactctgc tggtgctagg tatggtgtgg gtggcatcag ccattgtgga caagaacaag gccaacagag agtcactcta tgacttttgg gagtactatc tcccctacct ctactcatgc atctccttcc ttggggttct gctgctcctg gtgtgtactc cactgggtct cgcccgcatg ttctccgtca ctgggaagct gctagtcaag ccccggctgc tggaagacct ggaggagcag ctgtactgct cagcctttga ggaggcagcc ctgacccgca ggatctgtaa tcctacttcc tgctggctgc ctttagacat ggagctgcta cacagacagg tcctggctct gcagacacag agggtcctgc tggagaagag gcggaaggct tcagcctggc aacggaacct gggctacccc ctggctatgc tgtgcttgct ggtgctgacg ggcctgtctg ttctcattgt ggccatccac atcctggagc tgctcatcga tgaggctgcc atgccccgag gcatgcaggg tacctcctta ggccaggtct ccttctccaa gctgggctcc tttggtgccg tcattcaggt tgtactcatc ttttacctaa tggtgtcctc agttgtgggc ttctatagct ctccactctt ccggagcctg cggcccagat ggcacgacac tgccatgacg cagataattg ggaactgtgt ctgtctcctg gtcctaagct cagcacttcc tgtcttctct cgaaccctgg ggctcactcg ctttgacctg ctgggtgact ttggacgctt caactggctg ggcaatttct acattgtgtt cctctacaac gcagcctttg caggcctcac cacactctgt ctggtgaaga ccttcactgc agctgtgcgg gcagagctga tccgggcctt tgggctggac agactgccgc tgcccgtctc cggtttcccc caggcatcta ggaagaccca gcaccagtga. It is sometimes possible for the material contained within the vial of "LMBR1L, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
