Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LIPT1 cdna clone

LIPT1 cDNA Clone

Gene Names
LIPT1; LIPT1D
Synonyms
LIPT1; LIPT1 cDNA Clone; LIPT1 cdna clone
Ordering
For Research Use Only!
Sequence
atgctgatcccattttcaatgaagaattgcttccagttactttgtaactgccaggtcccagcagctggctttaaaaaaacagtaaaaaatgggctcattttacagtcaatttccaatgatgtctatcaaaatctggctgtggaagactggatccatgaccatatgaatctagaaggcaaaccaattctattcttttggcagaattctccctctgttgtaattggtaggcatcaaaatccttggcaggaatgtaacctgaatctaatgagagaagaaggtataaaactggctcggagaagaagtggaggaggaacagtctaccatgatatgggtaatatcaatttgactttctttacaaccaaaaaaaagtatgatagaatggaaaatctgaaattaattgtgagagctctgaatgctgtccaaccccagctggatgtgcaggctaccaaaagatttgaccttttacttgatggacagtttaaaatctcaggaacagcttctaagatcggccggactactgcctatcaccattgcactttattatgtagtactgatgggacgttcttgtcttctttgctaaagagcccttaccaagggatcaggagcaatgccactgctagcataccttccttagtgaaaaatcttttggaaaaggatcccactctgacctgtgaagtactaatgaatgctgttgctacagagtatgctgcttatcatcaaattgataatcacattcacctaataaacccaacggatgagacactgtttcctggaataaatagcaaagccaaagaactgcaaacttgggagtggatatatggcaaaactccaaagtttagtataaatacttcctttcatgtgttatatgaacagtcacacttggaaattaaagtattcatagacataaagaatggaagaattgaaatttgtaatattgaagcacctgatcattggttgccattggaaatacgtgacaaattaaattcaagtcttattggcagtaagttttgcccaactgaaactaccatgctaacaaatatattacttagaacatgtccacaagaccacaaactaaacagtaaatggaatattctctgtgaaaaaattaagggaataatgtga
Sequence Length
1122
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
42,479 Da
NCBI Official Full Name
Homo sapiens lipoyltransferase 1, mRNA
NCBI Official Synonym Full Names
lipoyltransferase 1
NCBI Official Symbol
LIPT1
NCBI Official Synonym Symbols
LIPT1D
NCBI Protein Information
lipoyltransferase 1, mitochondrial
UniProt Protein Name
Lipoyltransferase 1, mitochondrial
Protein Family
UniProt Gene Name
LIPT1
UniProt Entry Name
LIPT_HUMAN

NCBI Description

The process of transferring lipoic acid to proteins is a two-step process. The first step is the activation of lipoic acid by lipoate-activating enzyme to form lipoyl-AMP. For the second step, the protein encoded by this gene transfers the lipoyl moiety to apoproteins. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 13. Read-through transcription also exists between this gene and the neighboring downstream mitochondrial ribosomal protein L30 (MRPL30) gene. [provided by RefSeq, Mar 2011]

Uniprot Description

LIPT1: Catalyzes the transfer of the lipoyl group from lipoyl- AMP to the specific lysine residue of lipoyl domains of lipoate- dependent enzymes. Belongs to the LplA family.

Protein type: EC 2.3.1.-; Cofactor and Vitamin Metabolism - lipoic acid; Transferase

Chromosomal Location of Human Ortholog: 2q11.2

Cellular Component: mitochondrial matrix

Molecular Function: transferase activity, transferring acyl groups

Biological Process: glyoxylate metabolic process; lipid metabolic process; protein modification process

Disease: Lipoyltransferase 1 Deficiency

Research Articles on LIPT1

Similar Products

Product Notes

The LIPT1 lipt1 (Catalog #AAA1275175) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgatcc cattttcaat gaagaattgc ttccagttac tttgtaactg ccaggtccca gcagctggct ttaaaaaaac agtaaaaaat gggctcattt tacagtcaat ttccaatgat gtctatcaaa atctggctgt ggaagactgg atccatgacc atatgaatct agaaggcaaa ccaattctat tcttttggca gaattctccc tctgttgtaa ttggtaggca tcaaaatcct tggcaggaat gtaacctgaa tctaatgaga gaagaaggta taaaactggc tcggagaaga agtggaggag gaacagtcta ccatgatatg ggtaatatca atttgacttt ctttacaacc aaaaaaaagt atgatagaat ggaaaatctg aaattaattg tgagagctct gaatgctgtc caaccccagc tggatgtgca ggctaccaaa agatttgacc ttttacttga tggacagttt aaaatctcag gaacagcttc taagatcggc cggactactg cctatcacca ttgcacttta ttatgtagta ctgatgggac gttcttgtct tctttgctaa agagccctta ccaagggatc aggagcaatg ccactgctag cataccttcc ttagtgaaaa atcttttgga aaaggatccc actctgacct gtgaagtact aatgaatgct gttgctacag agtatgctgc ttatcatcaa attgataatc acattcacct aataaaccca acggatgaga cactgtttcc tggaataaat agcaaagcca aagaactgca aacttgggag tggatatatg gcaaaactcc aaagtttagt ataaatactt cctttcatgt gttatatgaa cagtcacact tggaaattaa agtattcata gacataaaga atggaagaat tgaaatttgt aatattgaag cacctgatca ttggttgcca ttggaaatac gtgacaaatt aaattcaagt cttattggca gtaagttttg cccaactgaa actaccatgc taacaaatat attacttaga acatgtccac aagaccacaa actaaacagt aaatggaata ttctctgtga aaaaattaag ggaataatgt ga. It is sometimes possible for the material contained within the vial of "LIPT1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.