Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LIMS3 cdna clone

LIMS3 cDNA Clone

Gene Names
LIMS3; PINCH-3
Synonyms
LIMS3; LIMS3 cDNA Clone; LIMS3 cdna clone
Ordering
For Research Use Only!
Sequence
ATGGCCTTCTCAGGCCGAGCGCGCCCCTGCATTATCCCAGAGAACGAAGAAATCCCCCGAGCAGCCCTTAACACTGTCCACGAGGCCAATGGGACCGAGGACGAGAGGGCTGTTTCCAAACTGCAGCGCAGGCACAGTGACGTGAAAGTCTACAAGGAGTTCTGTGACTTTTATGCGAAATTCAACATGGCCAACGCCCTGGCCAGCGCCACTTGCGAGCGCTGCAAGGGCGGCTTTGCGCCCGCTGAGACGATCGTGAACAGTAATGGGGAGCTGTACCATGAGCAGTGTTTCGTGTGCGCTCAGTGCTTCCAGCAGTTCCCAGAAGGACTCTTCTATGAGGAACGAACGTGA
Sequence Length
354
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
28,092 Da
NCBI Official Full Name
Homo sapiens LIM and senescent cell antigen-like domains 3, mRNA
NCBI Official Synonym Full Names
LIM zinc finger domain containing 3
NCBI Official Symbol
LIMS3
NCBI Official Synonym Symbols
PINCH-3
NCBI Protein Information
LIM and senescent cell antigen-like-containing domain protein 3
UniProt Protein Name
LIM and senescent cell antigen-like-containing domain protein 3
UniProt Gene Name
LIMS3
UniProt Synonym Gene Names
PINCH3; PINCH-3
UniProt Entry Name
LIMS3_HUMAN

Uniprot Description

LIMS3: 2 isoforms of the human protein are produced by alternative splicing

Protein type: Unknown function

Chromosomal Location of Human Ortholog: 2q13

Research Articles on LIMS3

Similar Products

Product Notes

The LIMS3 lims3 (Catalog #AAA1268993) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGGCCTTCT CAGGCCGAGC GCGCCCCTGC ATTATCCCAG AGAACGAAGA AATCCCCCGA GCAGCCCTTA ACACTGTCCA CGAGGCCAAT GGGACCGAGG ACGAGAGGGC TGTTTCCAAA CTGCAGCGCA GGCACAGTGA CGTGAAAGTC TACAAGGAGT TCTGTGACTT TTATGCGAAA TTCAACATGG CCAACGCCCT GGCCAGCGCC ACTTGCGAGC GCTGCAAGGG CGGCTTTGCG CCCGCTGAGA CGATCGTGAA CAGTAATGGG GAGCTGTACC ATGAGCAGTG TTTCGTGTGC GCTCAGTGCT TCCAGCAGTT CCCAGAAGGA CTCTTCTATG AGGAACGAAC GTGA. It is sometimes possible for the material contained within the vial of "LIMS3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.