Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

LHFPL3 cdna clone

LHFPL3 cDNA Clone

Gene Names
LHFPL3; LHFPL4
Synonyms
LHFPL3; LHFPL3 cDNA Clone; LHFPL3 cdna clone
Ordering
 
When autocomplete results are available use up and down arrows to review and enter to select. Touch device users, explore by touch or with swipe gestures.
For Research Use Only!
Sequence
ATGCCCGGAGCCGCCGCCGCTGCCGCCGCCGCCGCCGCCGCGATGCTCCCGGCTCAGGAGGCTGCCAAGCTGTACCACACCAACTATGTGCGGAACTCGCGGGCCATCGGCGTGCTGTGGGCCATCTTCACCATCTGCTTTGCCATCGTCAACGTGGTGTGCTTCATCCAGCCCTACTGGATAGGCGACGGCGTGGACACCCCGCAAGCCGGCTATTTCGGGCTCTTCCACTACTGCATCGGCAACGGCTTCTCCCGGGAGCTGACCTGCAGGGGCAGCTTCACGGACTTCTCCACGCTGCCCTCGGGCGCCTTCAAAGCCGCCTCCTTCTTTATCGGCCTCTCCATGATGCTCATCATTGCCTGCATCATTTGCTTTACCCTCTTCTTCTTCTGCAACACGGCCACTGTGTACAAGATATGTGCCTGGATGCAGCTCACCTCCGCTGCCTGCCTTGTGCTTGGCTGTATGATTTTCCCTGATGGCTGGGACTCAGATGAAGTAAAACGGATGTGTGGAGAAAAGACAGACAAGTACACTCTTGGGGCTTGCTCAGTCCGCTGGGCATACATCCTGGCTATTATTGGAATTTTGGATGCCCTGATCCTCTCATTTCTAGCATTTGTGCTTGGTAATCGACAAGACAGCTTGATGGCAGAGGAACTGAAGGCAGAAAACAAAGATGATGGAAATGCTTAA
Sequence Length
699
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
25,769 Da
NCBI Official Full Name
Homo sapiens lipoma HMGIC fusion partner-like 3, mRNA
NCBI Official Synonym Full Names
lipoma HMGIC fusion partner-like 3
NCBI Official Symbol
LHFPL3
NCBI Official Synonym Symbols
LHFPL4
NCBI Protein Information
lipoma HMGIC fusion partner-like 3 protein
UniProt Protein Name
Lipoma HMGIC fusion partner-like 3 protein
UniProt Gene Name
LHFPL3
UniProt Synonym Gene Names
LHFPL4
UniProt Entry Name
LHPL3_HUMAN

NCBI Description

This gene is a member of the lipoma HMGIC fusion partner (LHFP) gene family, which is a subset of the superfamily of tetraspan transmembrane protein encoding genes. Mutations in one LHFP-like gene result in deafness in humans and mice, and a second LHFP-like gene is fused to a high-mobility group gene in a translocation-associated lipoma. A partial gene fragment named LHFPL4 corresponds to a portion of the first exon of this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

LHFPL3: a member of the lipoma HMGIC fusion partner (LHFP) gene family, which is a subset of the superfamily of tetraspan transmembrane protein encoding genes. Mutations in one LHFP-like gene result in deafness in humans and mice, and a second LHFP-like gene is fused to a high-mobility group gene in a translocation-associated lipoma. A partial gene fragment named LHFPL4 corresponds to a portion of the first exon of this gene. [provided by RefSeq, Jul 2008]

Protein type: Membrane protein, integral; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 7q22.2

Research Articles on LHFPL3

Similar Products

Product Notes

The LHFPL3 lhfpl3 (Catalog #AAA1277447) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGCCCGGAG CCGCCGCCGC TGCCGCCGCC GCCGCCGCCG CGATGCTCCC GGCTCAGGAG GCTGCCAAGC TGTACCACAC CAACTATGTG CGGAACTCGC GGGCCATCGG CGTGCTGTGG GCCATCTTCA CCATCTGCTT TGCCATCGTC AACGTGGTGT GCTTCATCCA GCCCTACTGG ATAGGCGACG GCGTGGACAC CCCGCAAGCC GGCTATTTCG GGCTCTTCCA CTACTGCATC GGCAACGGCT TCTCCCGGGA GCTGACCTGC AGGGGCAGCT TCACGGACTT CTCCACGCTG CCCTCGGGCG CCTTCAAAGC CGCCTCCTTC TTTATCGGCC TCTCCATGAT GCTCATCATT GCCTGCATCA TTTGCTTTAC CCTCTTCTTC TTCTGCAACA CGGCCACTGT GTACAAGATA TGTGCCTGGA TGCAGCTCAC CTCCGCTGCC TGCCTTGTGC TTGGCTGTAT GATTTTCCCT GATGGCTGGG ACTCAGATGA AGTAAAACGG ATGTGTGGAG AAAAGACAGA CAAGTACACT CTTGGGGCTT GCTCAGTCCG CTGGGCATAC ATCCTGGCTA TTATTGGAAT TTTGGATGCC CTGATCCTCT CATTTCTAGC ATTTGTGCTT GGTAATCGAC AAGACAGCTT GATGGCAGAG GAACTGAAGG CAGAAAACAA AGATGATGGA AATGCTTAA. It is sometimes possible for the material contained within the vial of "LHFPL3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.
Looking for a specific manual?
Request a Manual