Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LGALS8 cdna clone

LGALS8 cDNA Clone

Gene Names
LGALS8; Gal-8; PCTA1; PCTA-1; Po66-CBP
Synonyms
LGALS8; LGALS8 cDNA Clone; LGALS8 cdna clone
Ordering
For Research Use Only!
Sequence
atgttgtccttaaacaacctacagaatatcatctataacccggtaatcccgtttgttggcaccattcctgatcagctggatcctggaactttgattgtgatacgtgggcatgttcctagtgacgcagacagattccaggtggatctgcagaatggcagcagcatgaaacctcgagccgatgtggcctttcatttcaatcctcgtttcaaaagggccggctgcattgtttgcaatactttgataaatgaaaaatggggacgggaagagatcacctatgacacgcctttcaaaagagaaaagtcttttgagatcgtgattatggtgctgaaggacaaattccaggtggctgtaaatggaaaacatactctgctctatggccacaggatcggcccagagaaaatagacactctgggcatttatggcaaagtgaatattcactcaattggttttagcttcagctcggacttacaaagtacccaagcatctagtctggaactgacagagataagtagagaaaatgttccaaagtctggcacgccccagcttaggctgccattcgctgcaaggttgaacacccccatgggccctggacgaactgtcgtcgttaaaggagaagtgaatgcaaatgccaaaagctttaatgttgacctactagcaggaaaatcaaaggatattgctctacacttgaacccacgcctgaatattaaagcatttgtaagaaattcttttcttcaggagtcctggggagaagaagagagaaatattacctctttcccatttagtcctgggatgtactttgagatgataatttattgtgatgttagagaattcaaggttgcagtaaatggcgtacacagcctggagtacaaacacagatttaaagagctcagcagtattgacacgctggaaattaatggagacatccacttactggaagtaaggagctggtag
Sequence Length
951
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
40,397 Da
NCBI Official Full Name
Homo sapiens lectin, galactoside-binding, soluble, 8, mRNA
NCBI Official Synonym Full Names
galectin 8
NCBI Official Symbol
LGALS8
NCBI Official Synonym Symbols
Gal-8; PCTA1; PCTA-1; Po66-CBP
NCBI Protein Information
galectin-8
UniProt Protein Name
Galectin-8
Protein Family
UniProt Gene Name
LGALS8
UniProt Synonym Gene Names
Gal-8; Po66-CBP; PCTA-1
UniProt Entry Name
LEG8_HUMAN

NCBI Description

This gene encodes a member of the galectin family. Galectins are beta-galactoside-binding animal lectins with conserved carbohydrate recognition domains. The galectins have been implicated in many essential functions including development, differentiation, cell-cell adhesion, cell-matrix interaction, growth regulation, apoptosis, and RNA splicing. This gene is widely expressed in tumoral tissues and seems to be involved in integrin-like cell interactions. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]

Uniprot Description

galectin-8: 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Cell adhesion

Chromosomal Location of Human Ortholog: 1q43

Cellular Component: cytosol; extracellular space; membrane

Molecular Function: carbohydrate binding; protein binding

Research Articles on LGALS8

Similar Products

Product Notes

The LGALS8 lgals8 (Catalog #AAA1274961) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttgtcct taaacaacct acagaatatc atctataacc cggtaatccc gtttgttggc accattcctg atcagctgga tcctggaact ttgattgtga tacgtgggca tgttcctagt gacgcagaca gattccaggt ggatctgcag aatggcagca gcatgaaacc tcgagccgat gtggcctttc atttcaatcc tcgtttcaaa agggccggct gcattgtttg caatactttg ataaatgaaa aatggggacg ggaagagatc acctatgaca cgcctttcaa aagagaaaag tcttttgaga tcgtgattat ggtgctgaag gacaaattcc aggtggctgt aaatggaaaa catactctgc tctatggcca caggatcggc ccagagaaaa tagacactct gggcatttat ggcaaagtga atattcactc aattggtttt agcttcagct cggacttaca aagtacccaa gcatctagtc tggaactgac agagataagt agagaaaatg ttccaaagtc tggcacgccc cagcttaggc tgccattcgc tgcaaggttg aacaccccca tgggccctgg acgaactgtc gtcgttaaag gagaagtgaa tgcaaatgcc aaaagcttta atgttgacct actagcagga aaatcaaagg atattgctct acacttgaac ccacgcctga atattaaagc atttgtaaga aattcttttc ttcaggagtc ctggggagaa gaagagagaa atattacctc tttcccattt agtcctggga tgtactttga gatgataatt tattgtgatg ttagagaatt caaggttgca gtaaatggcg tacacagcct ggagtacaaa cacagattta aagagctcag cagtattgac acgctggaaa ttaatggaga catccactta ctggaagtaa ggagctggta g. It is sometimes possible for the material contained within the vial of "LGALS8, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.