Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LGALS3 cdna clone

LGALS3 cDNA Clone

Gene Names
LGALS3; L31; GAL3; MAC2; CBP35; GALBP; GALIG; LGALS2
Synonyms
LGALS3; LGALS3 cDNA Clone; LGALS3 cdna clone
Ordering
For Research Use Only!
Sequence
atggcagacaatttttcgctccatgatgcgttatctgggtctggaaacccaaaccctcaaggatggcctggcgcatgggggaaccagcctgctggggcagggggctacccaggggcttcctatcctggggcctaccccgggcaggcacccccaggggcttatcctggacaggcacctccaggcgcctaccatggagcacctggagcttatcccggagcacctgcacctggagtctacccagggccacccagcggccctggggcctacccatcttctggacagccaagtgcccccggagcctaccctgccactggcccctatggcgcccctgctgggccactgattgtgccttataacctgcctttgcctgggggagtggtgcctcgcatgctgataacaattctgggcacggtgaagcccaatgcaaacagaattgctttagatttccaaagagggaatgatgttgccttccactttaacccacgcttcaatgagaacaacaggagagtcattgtttgcaatacaaagctggataataactggggaagggaagaaagacagtcggttttcccatttgaaagtgggaaaccattcaaaatacaagtactggttgaacctgaccacttcaaggttgcagtgaatgatgctcacttgttgcagtacaatcatcgggttaaaaaactcaatgaaatcagcaaactgggaatttctggtgacatagacctcaccagtgcttcatataccatgatataa
Sequence Length
753
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
UniProt Accession #
Molecular Weight
26,152 Da
NCBI Official Full Name
Homo sapiens lectin, galactoside-binding, soluble, 3, mRNA
NCBI Official Synonym Full Names
lectin, galactoside-binding, soluble, 3
NCBI Official Symbol
LGALS3
NCBI Official Synonym Symbols
L31; GAL3; MAC2; CBP35; GALBP; GALIG; LGALS2
NCBI Protein Information
galectin-3; lectin L-29; 35 kDa lectin; MAC-2 antigen; IgE-binding protein; laminin-binding protein; galactose-specific lectin 3; carbohydrate-binding protein 35
UniProt Protein Name
Galectin-3
UniProt Gene Name
LGALS3
UniProt Synonym Gene Names
MAC2; Gal-3; CBP 35; GALBP
UniProt Entry Name
LEG3_HUMAN

NCBI Description

This gene encodes a member of the galectin family of carbohydrate binding proteins. Members of this protein family have an affinity for beta-galactosides. The encoded protein is characterized by an N-terminal proline-rich tandem repeat domain and a single C-terminal carbohydrate recognition domain. This protein can self-associate through the N-terminal domain allowing it to bind to multivalent saccharide ligands. This protein localizes to the extracellular matrix, the cytoplasm and the nucleus. This protein plays a role in numerous cellular functions including apoptosis, innate immunity, cell adhesion and T-cell regulation. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Apr 2010]

Uniprot Description

Galectin-3: galactose-specific lectin which binds IgE. Expressed at a high level in the colonic epithelium. Also abundant in activated macrophages.

Protein type: Cell surface; Motility/polarity/chemotaxis; Extracellular matrix

Chromosomal Location of Human Ortholog: 14q22.3

Cellular Component: extracellular matrix; spliceosome; extracellular space; proteinaceous extracellular matrix; membrane; mitochondrial inner membrane; cytoplasm; plasma membrane; immunological synapse; nucleus; external side of plasma membrane

Molecular Function: protein binding; laminin binding; IgE binding; carbohydrate binding; chemoattractant activity

Biological Process: neutrophil chemotaxis; extracellular matrix organization and biogenesis; RNA splicing; negative regulation of endocytosis; regulation of T cell proliferation; negative regulation of T cell receptor signaling pathway; macrophage chemotaxis; monocyte chemotaxis; positive chemotaxis; epithelial cell differentiation; eosinophil chemotaxis; innate immune response; mRNA processing; skeletal development

Research Articles on LGALS3

Similar Products

Product Notes

The LGALS3 lgals3 (Catalog #AAA1265837) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagaca atttttcgct ccatgatgcg ttatctgggt ctggaaaccc aaaccctcaa ggatggcctg gcgcatgggg gaaccagcct gctggggcag ggggctaccc aggggcttcc tatcctgggg cctaccccgg gcaggcaccc ccaggggctt atcctggaca ggcacctcca ggcgcctacc atggagcacc tggagcttat cccggagcac ctgcacctgg agtctaccca gggccaccca gcggccctgg ggcctaccca tcttctggac agccaagtgc ccccggagcc taccctgcca ctggccccta tggcgcccct gctgggccac tgattgtgcc ttataacctg cctttgcctg ggggagtggt gcctcgcatg ctgataacaa ttctgggcac ggtgaagccc aatgcaaaca gaattgcttt agatttccaa agagggaatg atgttgcctt ccactttaac ccacgcttca atgagaacaa caggagagtc attgtttgca atacaaagct ggataataac tggggaaggg aagaaagaca gtcggttttc ccatttgaaa gtgggaaacc attcaaaata caagtactgg ttgaacctga ccacttcaag gttgcagtga atgatgctca cttgttgcag tacaatcatc gggttaaaaa actcaatgaa atcagcaaac tgggaatttc tggtgacata gacctcacca gtgcttcata taccatgata taa. It is sometimes possible for the material contained within the vial of "LGALS3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.