LETMD1 cdna clone

LETMD1 cDNA Clone

Gene Names

LETMD1; HCCR; HCCR1; HCCR2; HCCR-1; HCCR-2; HCRR-2; 1110019O13Rik

Synonyms

LETMD1; LETMD1 cDNA Clone; LETMD1 cdna clone

Ordering
Cat. Num. AAA1274162 For Research Use Only!

Sequence

atggcgctctccagggtgtgctgggctcggtcggctgtgtggggctcggcagtcacccctggacattttgtcacccggaggctgcaacttggtcgctctggcctggcttggggggcccctcggtcttcaaagcttcacctttctccaaaggcagatgtgaagaacttgatgtcttatgtggtaaccaagacaaaagcgattaatgggaaataccatcgtttcttgggtcgtcatttcccccgcttctatgtcctgtacacaatcttcatgaaaggattgcagatgttatgggctgatgccaaaaaggctagaagaataaagacaaatatgtggaagcacaatataaagtttcatcaacttccataccgggagatggagcatttgagacagttccgccaagacgtcaccaagtgtcttttcctaggtattatttccattccaccttttgccaactacctggtcttcttgctaatgtacctgtttcccaggcaactactgatcaggcatttctggaccccaaaacaacaaactgatttcttagatatctatcatgctttccggaagcagtcccacccagaaattattagttatttagaaaaggtcatccctctcatttctgatgcaggactccggtggcgtctgacagatctgtgcaccaagatacagcgtggtacccacccagcaatacatgatatcttggctctgagagagtgtttctctaaccatcctctgggcatgaaccaactccaggctttgcacgtgaaagccttgagccgggccatgcttctcacatcttacctgcctcctcccttgttgagacatcgtttgaagactcatacaactgtgattcaccaactggacaaggctttggcaaagctggggattggccagctgactgctcaggaagtaaaatcggcttgttatctccgtggcctgaattctacgcatattggtgaagataggtgtcgaacttggctgggagaatggctgcagatttcctgcagcctgaaagaagctgagctgtctctcttgctgcacaacgtggtcctgctctccaccaactaccttgggacaaggcgctga

Sequence Length

1083

Vector

pENTR223.1 or pUC

Clone Sequence Report

Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #

40787746

NCBI GeneID

25875

Molecular Weight

43,328 Da

NCBI Official Full Name

Homo sapiens LETM1 domain containing 1, mRNA

NCBI Official Synonym Full Names

LETM1 domain containing 1

NCBI Official Symbol

LETMD1

NCBI Official Synonym Symbols

HCCR; HCCR1; HCCR2; HCCR-1; HCCR-2; HCRR-2; 1110019O13Rik

NCBI Protein Information

LETM1 domain-containing protein 1

UniProt Protein Name

LETM1 domain-containing protein 1

Protein Family

LETM1 domain-containing protein

UniProt Gene Name

LETMD1

UniProt Entry Name

LTMD1_HUMAN

NCBI Description

This gene encodes a mitochondrial outer membrane protein. It has a potential role in tumorigenesis, which may result from negative regulation of the p53 tumor suppressor gene. Alternatively spliced transcript variants have been noted for this gene. [provided by RefSeq, Aug 2011]

Uniprot Description

LETMD1: Involved in tumorigenesis and may function as a negative regulator of the p53/TP53. 6 isoforms of the human protein are produced by alternative splicing.

Protein type: Oncoprotein; Membrane protein, integral

Chromosomal Location of Human Ortholog: 12q13.12

Molecular Function: protein binding

Research Articles on LETMD1

1. Demonstrate that HBx-HCCR-E-cadherin regulation pathway might play an important role in HBV-induced hepatocarcinogenesis.

Similar Products

Product Notes

The LETMD1 letmd1 (Catalog #AAA1274162) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgctct ccagggtgtg ctgggctcgg tcggctgtgt ggggctcggc agtcacccct ggacattttg tcacccggag gctgcaactt ggtcgctctg gcctggcttg gggggcccct cggtcttcaa agcttcacct ttctccaaag gcagatgtga agaacttgat gtcttatgtg gtaaccaaga caaaagcgat taatgggaaa taccatcgtt tcttgggtcg tcatttcccc cgcttctatg tcctgtacac aatcttcatg aaaggattgc agatgttatg ggctgatgcc aaaaaggcta gaagaataaa gacaaatatg tggaagcaca atataaagtt tcatcaactt ccataccggg agatggagca tttgagacag ttccgccaag acgtcaccaa gtgtcttttc ctaggtatta tttccattcc accttttgcc aactacctgg tcttcttgct aatgtacctg tttcccaggc aactactgat caggcatttc tggaccccaa aacaacaaac tgatttctta gatatctatc atgctttccg gaagcagtcc cacccagaaa ttattagtta tttagaaaag gtcatccctc tcatttctga tgcaggactc cggtggcgtc tgacagatct gtgcaccaag atacagcgtg gtacccaccc agcaatacat gatatcttgg ctctgagaga gtgtttctct aaccatcctc tgggcatgaa ccaactccag gctttgcacg tgaaagcctt gagccgggcc atgcttctca catcttacct gcctcctccc ttgttgagac atcgtttgaa gactcataca actgtgattc accaactgga caaggctttg gcaaagctgg ggattggcca gctgactgct caggaagtaa aatcggcttg ttatctccgt ggcctgaatt ctacgcatat tggtgaagat aggtgtcgaa cttggctggg agaatggctg cagatttcct gcagcctgaa agaagctgag ctgtctctct tgctgcacaa cgtggtcctg ctctccacca actaccttgg gacaaggcgc tga. It is sometimes possible for the material contained within the vial of "LETMD1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

LETMD1 cdna clone