Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LEPROTL1 cdna clone

LEPROTL1 cDNA Clone

Gene Names
LEPROTL1; Vps55; my047; HSPC112
Synonyms
LEPROTL1; LEPROTL1 cDNA Clone; LEPROTL1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcaggcatcaaagctttgattagtttgtcctttggaggagcaatcggactgatgtttttgatgcttggatgtgcccttccaatatacaacaaatactggcccctctttgttctatttttttacatcctttcacctattccatactgcatagcaagaagattagtggatgatacagatgctatgagtaacgcttgtaaggaacttgccatctttcttacaacgggcattgtcgtgtcagcttttggactccctattgtatttgccagagcacatctgattgagtggggagcttgtgcacttgttctcacaggaaacacagtcatctttgcaactatactaggctttttcttggtctttggaagcaatgacgacttcagctggcagcagtggtga
Sequence Length
396
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
18,366 Da
NCBI Official Full Name
Homo sapiens leptin receptor overlapping transcript-like 1, mRNA
NCBI Official Synonym Full Names
leptin receptor overlapping transcript-like 1
NCBI Official Symbol
LEPROTL1
NCBI Official Synonym Symbols
Vps55; my047; HSPC112
NCBI Protein Information
leptin receptor overlapping transcript-like 1
UniProt Protein Name
Leptin receptor overlapping transcript-like 1
UniProt Gene Name
LEPROTL1
UniProt Entry Name
LERL1_HUMAN

Uniprot Description

LEPROTL1: Negatively regulates growth hormone (GH) receptor cell surface expression in liver. May play a role in liver resistance to GH during periods of reduced nutrient availability. Belongs to the OB-RGRP/VPS55 family.

Protein type: Membrane protein, integral; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 8p12

Research Articles on LEPROTL1

Similar Products

Product Notes

The LEPROTL1 leprotl1 (Catalog #AAA1266379) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcaggca tcaaagcttt gattagtttg tcctttggag gagcaatcgg actgatgttt ttgatgcttg gatgtgccct tccaatatac aacaaatact ggcccctctt tgttctattt ttttacatcc tttcacctat tccatactgc atagcaagaa gattagtgga tgatacagat gctatgagta acgcttgtaa ggaacttgcc atctttctta caacgggcat tgtcgtgtca gcttttggac tccctattgt atttgccaga gcacatctga ttgagtgggg agcttgtgca cttgttctca caggaaacac agtcatcttt gcaactatac taggcttttt cttggtcttt ggaagcaatg acgacttcag ctggcagcag tggtga. It is sometimes possible for the material contained within the vial of "LEPROTL1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.