LCE2D cdna clone
LCE2D cDNA Clone
Gene Names
LCE2D; LEP12; SPRL1A
Synonyms
LCE2D; LCE2D cDNA Clone; LCE2D cdna clone
Sequence
atgtcttgccagcaaaaccagcagcagtgccagccccctcccaaatgtcctcccaagtgtaccccaaaatgtccacctaagtgtccccccaaatgcccaccacagtgcccagctccatgttcccctgcagtctcttcctgctgtggtcccagctctgggagctgctgtggtcccagctctgggggctgctgcagctctgggggtggtggctgctgcctgagccaccacaggccccgtctcttccaccggcgccggcaccagagccccgattgctgtgagagtgaaccttctggggcctctggctgctgccacagctctgggggctgctgctga
Sequence Length
333
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
11,180 Da
NCBI Official Full Name
Homo sapiens late cornified envelope 2D, mRNA
NCBI Official Synonym Full Names
late cornified envelope 2D
NCBI Official Symbol
LCE2D
NCBI Official Synonym Symbols
LEP12; SPRL1A
NCBI Protein Information
late cornified envelope protein 2D
UniProt Protein Name
Late cornified envelope protein 2D
Protein Family
UniProt Gene Name
LCE2D
UniProt Synonym Gene Names
LEP12; SPRL1A
UniProt Entry Name
LCE2D_HUMAN
Uniprot Description
LCE2D: Precursors of the cornified envelope of the stratum corneum. Belongs to the LCE family.
Chromosomal Location of Human Ortholog: 1q21.3
Cellular Component: cornified envelope; cytoplasm
Molecular Function: protein binding; structural molecule activity
Biological Process: keratinocyte differentiation; peptide cross-linking
Research Articles on LCE2D
Similar Products
Product Notes
The LCE2D lce2d (Catalog #AAA1270502) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcttgcc agcaaaacca gcagcagtgc cagccccctc ccaaatgtcc tcccaagtgt accccaaaat gtccacctaa gtgtcccccc aaatgcccac cacagtgccc agctccatgt tcccctgcag tctcttcctg ctgtggtccc agctctggga gctgctgtgg tcccagctct gggggctgct gcagctctgg gggtggtggc tgctgcctga gccaccacag gccccgtctc ttccaccggc gccggcacca gagccccgat tgctgtgaga gtgaaccttc tggggcctct ggctgctgcc acagctctgg gggctgctgc tga. It is sometimes possible for the material contained within the vial of "LCE2D, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
