LAS1L cdna clone
LAS1L cDNA Clone
Gene Names
LAS1L; WTS; Las1-like; dJ475B7.2
Synonyms
LAS1L; LAS1L cDNA Clone; LAS1L cdna clone
Sequence
atgtcgtgggaatccggggccgggccaggtctaggttcccaggggatggatctcgtgtggagtgcgtggtacggaaagtgcgttaaagggaaagggtcgttgccactctcggcccacggcatcgtggtcgcctggctcagcagggccgagtgggaccaggtgacggtttatctgttctgtgacgaccataagttgcagcggtacgcgcttaaccgcatcacggtgtggaggagcaggtcaggcaacgaactccctctggcagtggcttctactgctgacctgatacgctgtaagctcttggatgtaactggtggcttgggcactgatgaacttagactgctctatggcatggcattggtcaggtttgtgaatcttatctcagagaggaagacaaagtttgccaaggtccccctcaagtgtctggctcaagaggtaaatattccggattggattgttgaccttcgccatgagttgacccacaagaaaatgccccatataaatgactgccgcagaggctgctactttgtcctggattggctccagaagacctattggtgccgccaactggagaacagcctgagagagacctgggagttggaggagttcagggaagggatagaggaagaggatcaagaggaagataagaacattgttgttgatgacatcacagaacagaaaccagagcctcaggatgatgggaaaagtacggagtcagatgtaaaggccgatggagacagcaaaggcagcgaagaggtggattctcattgcaaaaaggccctgagtcataaagagctatatgaaagagcccgagaactgctggtatcatacgaagaggagcagtttacggtgctggagaaatttaggtatttacctaaggccattaaggcgtggaataacccgtccccacgtgtagaatgtgtcctggcagagctcaagggcgttacatgcgagaacagggaggctgtgctggatgcttttctggatgatggcttccttgtccccacatttgaacagttggcagctttgcagatagaatatgaagaaaacgtggacttgaatgacgtcctggtgccaaagccgttctctcagttctggcagcccctgctcaggggcctgcactcccagaacttcacgcaggccctattggagaggatgctctctgaactgccagccttggggatcagcgggatccggcctacctacatcctcagatggaccgttgaactgatcgtggccaacaccaagactggacggaatgctcgccgattttctgcaggccagtgggaagcaagaaggggctggaggctgttcaactgctccgcctcccttgactggccccggatggttgagtcctgcttgggctcaccttgctgggccagcccccaactccttcggatcatcttcaaagccatggggcagggcctgccagacgaggagcaggagaagctgctgcgcatctgttccatttatacccagagtggagaaaacagcctggtgcaggagggctctgaggcctcccccattgggaagtctccatatacactagacagcctgtattggagcgtcaagccagccagctccagcttcgggtctgaagcaaaggcccagcaacaggaggagcagggcagtgttaatgatgtcaaggaagaggagaaggaggagaaagaggtcttgccagaccaggtagaggaggaggaagaaaatgatgaccaagaggaggaagaggaggatgaagatgatgaagatgatgaagaggaagacagaatggaggtggggcctttctctacagggcaagagtcccccactgccgagaatgctaggcttctggcccagaaaagaggagctttgcagggctctgcatggcaggttagctcagaagacgtgcgatgggacacatttcccctaggccgaatgccaggtcagaccgaggacccagcagagctcatgctggagaattatgacaccatgtatcttttggaccagcctgtgctagagcagcggctggaaccctcaacatgcaagactgacaccttgggcctgagctgtggtgtcggcagtggcaactgcagcaacagcagcagcagcaacttcgagggccttctctggagccaggggcagctgcatgggctcaaaactggcctgcagctcttctga
Sequence Length
2154
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
33,108 Da
NCBI Official Full Name
Homo sapiens LAS1-like (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
LAS1 like, ribosome biogenesis factor
NCBI Official Symbol
LAS1L
NCBI Official Synonym Symbols
WTS; Las1-like; dJ475B7.2
NCBI Protein Information
ribosomal biogenesis protein LAS1L
UniProt Protein Name
Ribosomal biogenesis protein LAS1L
Protein Family
UniProt Gene Name
LAS1L
UniProt Entry Name
LAS1L_HUMAN
Uniprot Description
LAS1L: a protein of unknown function.
Protein type: Nucleolus; RNA-binding
Chromosomal Location of Human Ortholog: Xq12
Cellular Component: cytoplasm; membrane; microtubule organizing center; nucleoplasm
Biological Process: endonucleolytic cleavages during rRNA processing; establishment and/or maintenance of chromatin architecture; maturation of 5.8S rRNA; maturation of LSU-rRNA; rRNA processing
Research Articles on LAS1L
Similar Products
Product Notes
The LAS1L las1l (Catalog #AAA1278610) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcgtggg aatccggggc cgggccaggt ctaggttccc aggggatgga tctcgtgtgg agtgcgtggt acggaaagtg cgttaaaggg aaagggtcgt tgccactctc ggcccacggc atcgtggtcg cctggctcag cagggccgag tgggaccagg tgacggttta tctgttctgt gacgaccata agttgcagcg gtacgcgctt aaccgcatca cggtgtggag gagcaggtca ggcaacgaac tccctctggc agtggcttct actgctgacc tgatacgctg taagctcttg gatgtaactg gtggcttggg cactgatgaa cttagactgc tctatggcat ggcattggtc aggtttgtga atcttatctc agagaggaag acaaagtttg ccaaggtccc cctcaagtgt ctggctcaag aggtaaatat tccggattgg attgttgacc ttcgccatga gttgacccac aagaaaatgc cccatataaa tgactgccgc agaggctgct actttgtcct ggattggctc cagaagacct attggtgccg ccaactggag aacagcctga gagagacctg ggagttggag gagttcaggg aagggataga ggaagaggat caagaggaag ataagaacat tgttgttgat gacatcacag aacagaaacc agagcctcag gatgatggga aaagtacgga gtcagatgta aaggccgatg gagacagcaa aggcagcgaa gaggtggatt ctcattgcaa aaaggccctg agtcataaag agctatatga aagagcccga gaactgctgg tatcatacga agaggagcag tttacggtgc tggagaaatt taggtattta cctaaggcca ttaaggcgtg gaataacccg tccccacgtg tagaatgtgt cctggcagag ctcaagggcg ttacatgcga gaacagggag gctgtgctgg atgcttttct ggatgatggc ttccttgtcc ccacatttga acagttggca gctttgcaga tagaatatga agaaaacgtg gacttgaatg acgtcctggt gccaaagccg ttctctcagt tctggcagcc cctgctcagg ggcctgcact cccagaactt cacgcaggcc ctattggaga ggatgctctc tgaactgcca gccttgggga tcagcgggat ccggcctacc tacatcctca gatggaccgt tgaactgatc gtggccaaca ccaagactgg acggaatgct cgccgatttt ctgcaggcca gtgggaagca agaaggggct ggaggctgtt caactgctcc gcctcccttg actggccccg gatggttgag tcctgcttgg gctcaccttg ctgggccagc ccccaactcc ttcggatcat cttcaaagcc atggggcagg gcctgccaga cgaggagcag gagaagctgc tgcgcatctg ttccatttat acccagagtg gagaaaacag cctggtgcag gagggctctg aggcctcccc cattgggaag tctccatata cactagacag cctgtattgg agcgtcaagc cagccagctc cagcttcggg tctgaagcaa aggcccagca acaggaggag cagggcagtg ttaatgatgt caaggaagag gagaaggagg agaaagaggt cttgccagac caggtagagg aggaggaaga aaatgatgac caagaggagg aagaggagga tgaagatgat gaagatgatg aagaggaaga cagaatggag gtggggcctt tctctacagg gcaagagtcc cccactgccg agaatgctag gcttctggcc cagaaaagag gagctttgca gggctctgca tggcaggtta gctcagaaga cgtgcgatgg gacacatttc ccctaggccg aatgccaggt cagaccgagg acccagcaga gctcatgctg gagaattatg acaccatgta tcttttggac cagcctgtgc tagagcagcg gctggaaccc tcaacatgca agactgacac cttgggcctg agctgtggtg tcggcagtgg caactgcagc aacagcagca gcagcaactt cgagggcctt ctctggagcc aggggcagct gcatgggctc aaaactggcc tgcagctctt ctga. It is sometimes possible for the material contained within the vial of "LAS1L, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
