LAMP1 cdna clone
LAMP1 cDNA Clone
Gene Names
LAMP1; LAMPA; CD107a; LGP120
Synonyms
LAMP1; LAMP1 cDNA Clone; LAMP1 cdna clone
Sequence
atggcggcccccggcagcgcccggcgacccctgctgctgctactgctgttgctgctgctcggcctcatgcattgtgcgtcagcagcaatgtttatggtgaaaaatggcaacgggaccgcgtgcataatggccaacttctctgctgccttctcagtgaactacgacaccaagagtggccctaagaacatgacctttgacctgccatcagatgccacagtggtgctcaaccgcagctcctgtggaaaagagaacacttctgaccccagtctcgtgattgcttttggaagaggacatacactcactctcaatttcacgagaaatgcaacacgttacagcgtccagctcatgagttttgtttataacttgtcagacacacaccttttccccaatgcgagctccaaagaaatcaagactgtggaatctataactgacatcagggcagatatagataaaaaatacagatgtgttagtggcacccaggtccacatgaacaacgtgaccgtaacgctccatgatgccaccatccaggcgtacctttccaacagcagcttcagcaggggagagacacgctgtgaacaagacaggccttccccaaccacagcgccccctgcgccacccagcccctcgccctcacccgtgcccaagagcccctctgtggacaagtacaacgtgagcggcaccaacgggacctgcctgctggccagcatggggctgcagctgaacctcacctatgagaggaaggacaacacgacggtgacaaggcttctcaacatcaaccccaacaagacctcggccagcgggagctgcggcgcccacctggtgactctggagctgcacagcgagggcaccaccgtcctgctcttccagttcgggatgaatgcaagttctagccggtttttcctacaaggaatccagttgaatacaattcttcctgacgccagagaccctgcctttaaagctgccaacggctccctgcgagcgctgcaggccacagtcggcaattcctacaagtgcaacgcggaggagcacgtccgtgtcacgaaggcgttttcagtcaatatattcaaagtgtgggtccaggctttcaaggtggaaggtggccagtttggctctgtggaggagtgtctgctggacgagaacagcatgctgatccccatcgctgtgggtggtgccctggcggggctggtcctcatcgtcctcatcgcctacctcgtcggcaggaagaggagtcacgcaggctaccagactatctag
Sequence Length
1254
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
38,986 Da
NCBI Official Full Name
Homo sapiens lysosomal-associated membrane protein 1, mRNA
NCBI Official Synonym Full Names
lysosomal associated membrane protein 1
NCBI Official Symbol
LAMP1
NCBI Official Synonym Symbols
LAMPA; CD107a; LGP120
NCBI Protein Information
lysosome-associated membrane glycoprotein 1
UniProt Protein Name
Lysosome-associated membrane glycoprotein 1
Protein Family
UniProt Gene Name
LAMP1
UniProt Synonym Gene Names
LAMP-1; Lysosome-associated membrane protein 1
UniProt Entry Name
LAMP1_HUMAN
NCBI Description
The protein encoded by this gene is a member of a family of membrane glycoproteins. This glycoprotein provides selectins with carbohydrate ligands. It may also play a role in tumor cell metastasis. [provided by RefSeq, Jul 2008]
Uniprot Description
LAMP1: Presents carbohydrate ligands to selectins. Also implicated in tumor cell metastasis. Belongs to the LAMP family.
Protein type: Membrane protein, integral
Chromosomal Location of Human Ortholog: 13q34
Cellular Component: cytoplasm; endosome membrane; integral to plasma membrane; late endosome; lysosomal membrane; lysosome; membrane; perinuclear region of cytoplasm; plasma membrane
Molecular Function: enzyme binding; protein binding
Biological Process: induction of apoptosis by granzyme; positive regulation of natural killer cell degranulation; positive regulation of natural killer cell mediated cytotoxicity; protein stabilization
Research Articles on LAMP1
Similar Products
Product Notes
The LAMP1 lamp1 (Catalog #AAA1272974) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggccc ccggcagcgc ccggcgaccc ctgctgctgc tactgctgtt gctgctgctc ggcctcatgc attgtgcgtc agcagcaatg tttatggtga aaaatggcaa cgggaccgcg tgcataatgg ccaacttctc tgctgccttc tcagtgaact acgacaccaa gagtggccct aagaacatga cctttgacct gccatcagat gccacagtgg tgctcaaccg cagctcctgt ggaaaagaga acacttctga ccccagtctc gtgattgctt ttggaagagg acatacactc actctcaatt tcacgagaaa tgcaacacgt tacagcgtcc agctcatgag ttttgtttat aacttgtcag acacacacct tttccccaat gcgagctcca aagaaatcaa gactgtggaa tctataactg acatcagggc agatatagat aaaaaataca gatgtgttag tggcacccag gtccacatga acaacgtgac cgtaacgctc catgatgcca ccatccaggc gtacctttcc aacagcagct tcagcagggg agagacacgc tgtgaacaag acaggccttc cccaaccaca gcgccccctg cgccacccag cccctcgccc tcacccgtgc ccaagagccc ctctgtggac aagtacaacg tgagcggcac caacgggacc tgcctgctgg ccagcatggg gctgcagctg aacctcacct atgagaggaa ggacaacacg acggtgacaa ggcttctcaa catcaacccc aacaagacct cggccagcgg gagctgcggc gcccacctgg tgactctgga gctgcacagc gagggcacca ccgtcctgct cttccagttc gggatgaatg caagttctag ccggtttttc ctacaaggaa tccagttgaa tacaattctt cctgacgcca gagaccctgc ctttaaagct gccaacggct ccctgcgagc gctgcaggcc acagtcggca attcctacaa gtgcaacgcg gaggagcacg tccgtgtcac gaaggcgttt tcagtcaata tattcaaagt gtgggtccag gctttcaagg tggaaggtgg ccagtttggc tctgtggagg agtgtctgct ggacgagaac agcatgctga tccccatcgc tgtgggtggt gccctggcgg ggctggtcct catcgtcctc atcgcctacc tcgtcggcag gaagaggagt cacgcaggct accagactat ctag. It is sometimes possible for the material contained within the vial of "LAMP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
