KTI12 cdna clone
KTI12 cDNA Clone
Gene Names
KTI12; TOT4; SBBI81
Synonyms
KTI12; KTI12 cDNA Clone; KTI12 cdna clone
Sequence
atgccgctcgtggtgttttgcgggctgccgtacagcggcaagagccggcgtgctgaagagttgcgcgtggcgctggctgccgagggccgcgcggtgtacgtggtggacgacgcagctgtcctgggcgcagaggacccagcggtgtacggcgattctgcccgtgagaaggcattgcgtggagctctgcgagcctccgtggaacggcgcctgagtcgccacgacgtggtcatcctggactcgcttaactacatcaaaggtttccgttacgagctctactgcctggcacgggcggcgcgcaccccgctctgcctggtctactgcgtacggcccggcggcccgatcgcgggacctcaggtggcgggcgcgaacgagaaccctggccggaacgtcagtgtgagttggcggccacgcgctgaggaggacgggagagcccaggcggcgggcagcagcgtcctcagggaactgcatactgcggactctgtagtaaatggaagtgcccaggccgacgtacccaaggaactggagcgagaagaatccggggctgcggagtctccagctcttgtgactccggattcagagaaatctgcaaagcatgggtccggtgccttttactctcccgaactcctggaggccctaacgctgcgctttgaggctcccgattctcggaatcgctgggaccggcctttattcactttggtgggcctagaggagccgttgcccctggcggggatccgctctgccctgtttgagaaccgggccccaccaccccatcagtctacgcagtcccagcccctcgcctccggcagctttctgcaccagttggaccaggtcacgagtcaagtactggccggattgatggaagcgcagaagagcgctgtccccggggacttgctcacgcttcctggtaccacagagcacttgcggtttacccggcccttgaccatggcagaactgagtcgccttcgtcgccagtttatttcgtacactaaaatgcatcccaacaatgagaacttgccgcaactggccaacatgtttcttcagtatttgagccagagcctgcactga
Sequence Length
1065
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
38,616 Da
NCBI Official Full Name
Homo sapiens KTI12 homolog, chromatin associated (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
KTI12 chromatin associated homolog
NCBI Official Symbol
KTI12
NCBI Official Synonym Symbols
TOT4; SBBI81
NCBI Protein Information
protein KTI12 homolog
UniProt Protein Name
Protein KTI12 homolog
Protein Family
UniProt Gene Name
KTI12
UniProt Entry Name
KTI12_HUMAN
Uniprot Description
KTI12: Belongs to the KTI12 family.
Protein type: Unknown function
Chromosomal Location of Human Ortholog: 1p32.3
Molecular Function: protein binding
Similar Products
Product Notes
The KTI12 kti12 (Catalog #AAA1278414) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccgctcg tggtgttttg cgggctgccg tacagcggca agagccggcg tgctgaagag ttgcgcgtgg cgctggctgc cgagggccgc gcggtgtacg tggtggacga cgcagctgtc ctgggcgcag aggacccagc ggtgtacggc gattctgccc gtgagaaggc attgcgtgga gctctgcgag cctccgtgga acggcgcctg agtcgccacg acgtggtcat cctggactcg cttaactaca tcaaaggttt ccgttacgag ctctactgcc tggcacgggc ggcgcgcacc ccgctctgcc tggtctactg cgtacggccc ggcggcccga tcgcgggacc tcaggtggcg ggcgcgaacg agaaccctgg ccggaacgtc agtgtgagtt ggcggccacg cgctgaggag gacgggagag cccaggcggc gggcagcagc gtcctcaggg aactgcatac tgcggactct gtagtaaatg gaagtgccca ggccgacgta cccaaggaac tggagcgaga agaatccggg gctgcggagt ctccagctct tgtgactccg gattcagaga aatctgcaaa gcatgggtcc ggtgcctttt actctcccga actcctggag gccctaacgc tgcgctttga ggctcccgat tctcggaatc gctgggaccg gcctttattc actttggtgg gcctagagga gccgttgccc ctggcgggga tccgctctgc cctgtttgag aaccgggccc caccacccca tcagtctacg cagtcccagc ccctcgcctc cggcagcttt ctgcaccagt tggaccaggt cacgagtcaa gtactggccg gattgatgga agcgcagaag agcgctgtcc ccggggactt gctcacgctt cctggtacca cagagcactt gcggtttacc cggcccttga ccatggcaga actgagtcgc cttcgtcgcc agtttatttc gtacactaaa atgcatccca acaatgagaa cttgccgcaa ctggccaaca tgtttcttca gtatttgagc cagagcctgc actga. It is sometimes possible for the material contained within the vial of "KTI12, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
