Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KRT81 cdna clone

KRT81 cDNA Clone

Gene Names
KRT81; HB1; Hb-1; KRTHB1; MLN137; ghHkb1; hHAKB2-1
Synonyms
KRT81; KRT81 cDNA Clone; KRT81 cdna clone
Ordering
For Research Use Only!
Sequence
atgacctgcggatcaggatttggtgggcgcgccttcagctgcatctcggcctgcgggccgcggcccggccgctgctgcatcaccgccgccccctaccgtggcatctcctgctaccgcggcctcaccgggggcttcggcagccacagcgtgtgcggaggctttcgggccggctcctgcggacgcagcttcggctaccgctccgggggcgtgtgcgggcccagtcccccatgcatcaccaccgtgtcggtcaacgagagcctcctcacgcccctcaacctggagatcgaccccaacgcgcagtgcgtgaagcaggaggagaaggagcagatcaagtccctcaacagcaggttcgcggccttcatcgacaaggtgcgcttcctggagcagcagaacaaactgctggagacaaagctgccgttctaccagaaccgcgagtgttgccagagcaacctggagcccctgtttgagggctacatcgagactctgcggcgggaggccgagtgcgtggaggccgacagcgggaggctggcctcagagcttaaccacgtgcaggaggtgctggagggctacaagaagaagtatgaggaggaggtttctctgagagcaacagctgagaacgagtttgtggctctgaagaaggatgtggactgcgcctacctccgcaagtcagacctggaggccaacgtggaggccctgatccaggagatcgacttcctgaggcggctgtatgaggaggagatccgcattctccagtcgcacatctcagacacctccgtggttgtcaagctggacaacagccgggacctgaacatggactgcatcattgccgagattaaggcacagtatgacgacattgtcacccgcagccgggccgaggccgagtcctggtaccgcagcaagtgtgaggagatgaaggccacggtgatcaggcacggggagaccctgcgccgcaccaaggaggagatcaacgagctgaaccgcatgatccagaggctgacggccgaggtggagaatgccaagtgccagaactccaagctggaggccgcggtggcccagtctgagcagcagggtgaggcggccctcagtgatgcccgctgcaagctggccgagctggagggcgccctgcagaaggccaagcaggacatggcctgcctgatcagggagtaccaggaggtgatgaactccaagctgggcctggacatcgagatcgccacctacaggcgcctgctggagggcgaggagcagaggctatgtgaaggcattggggctgtgaatgtctgtgtcagcagctcccggggcggggtcgtgtgcggggacctctgcgtgtcaggctcccggccagtgactggcagtgtctgcagcgctccgtgcaacgggaacgtggcggtgagcaccggcctgtgtgcgccctgcggccaattgaacaccacctgcggagggggttcctgcggcgtgggctcctgtggtatcagctccctgggtgtggggtcttgcggcagcagctgccggaaatgttag
Sequence Length
1518
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
54,928 Da
NCBI Official Full Name
Homo sapiens keratin, hair, basic, 1, mRNA
NCBI Official Synonym Full Names
keratin 81
NCBI Official Symbol
KRT81
NCBI Official Synonym Symbols
HB1; Hb-1; KRTHB1; MLN137; ghHkb1; hHAKB2-1
NCBI Protein Information
keratin, type II cuticular Hb1
UniProt Protein Name
Keratin, type II cuticular Hb1
Protein Family
UniProt Gene Name
KRT81
UniProt Synonym Gene Names
KRTHB1; MLN137; K81; MLN 137; ghHb1
UniProt Entry Name
KRT81_HUMAN

NCBI Description

The protein encoded by this gene is a member of the keratin gene family. As a type II hair keratin, it is a basic protein which heterodimerizes with type I keratins to form hair and nails. The type II hair keratins are clustered in a region of chromosome 12q13 and are grouped into two distinct subfamilies based on structure similarity. One subfamily, consisting of KRTHB1, KRTHB3, and KRTHB6, is highly related. The other less-related subfamily includes KRTHB2, KRTHB4, and KRTHB5. All hair keratins are expressed in the hair follicle; this hair keratin, as well as KRTHB3 and KRTHB6, is found primarily in the hair cortex. Mutations in this gene and KRTHB6 have been observed in patients with a rare dominant hair disease, monilethrix. [provided by RefSeq, Jul 2008]

Uniprot Description

K81: a type II cytoskeletal keratin. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. There are two types of cytoskeletal and microfibrillar keratin: type I (acidic; 40-55 kDa) [K9 to K20] and type II (neutral to basic; 56-70 kDa) [K1 to K8]. Both a basic and an acidic keratin are required for filament assembly.

Protein type: Cytoskeletal; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 12q13

Cellular Component: extracellular space

Molecular Function: protein binding

Disease: Monilethrix

Research Articles on KRT81

Similar Products

Product Notes

The KRT81 krt81 (Catalog #AAA1273007) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacctgcg gatcaggatt tggtgggcgc gccttcagct gcatctcggc ctgcgggccg cggcccggcc gctgctgcat caccgccgcc ccctaccgtg gcatctcctg ctaccgcggc ctcaccgggg gcttcggcag ccacagcgtg tgcggaggct ttcgggccgg ctcctgcgga cgcagcttcg gctaccgctc cgggggcgtg tgcgggccca gtcccccatg catcaccacc gtgtcggtca acgagagcct cctcacgccc ctcaacctgg agatcgaccc caacgcgcag tgcgtgaagc aggaggagaa ggagcagatc aagtccctca acagcaggtt cgcggccttc atcgacaagg tgcgcttcct ggagcagcag aacaaactgc tggagacaaa gctgccgttc taccagaacc gcgagtgttg ccagagcaac ctggagcccc tgtttgaggg ctacatcgag actctgcggc gggaggccga gtgcgtggag gccgacagcg ggaggctggc ctcagagctt aaccacgtgc aggaggtgct ggagggctac aagaagaagt atgaggagga ggtttctctg agagcaacag ctgagaacga gtttgtggct ctgaagaagg atgtggactg cgcctacctc cgcaagtcag acctggaggc caacgtggag gccctgatcc aggagatcga cttcctgagg cggctgtatg aggaggagat ccgcattctc cagtcgcaca tctcagacac ctccgtggtt gtcaagctgg acaacagccg ggacctgaac atggactgca tcattgccga gattaaggca cagtatgacg acattgtcac ccgcagccgg gccgaggccg agtcctggta ccgcagcaag tgtgaggaga tgaaggccac ggtgatcagg cacggggaga ccctgcgccg caccaaggag gagatcaacg agctgaaccg catgatccag aggctgacgg ccgaggtgga gaatgccaag tgccagaact ccaagctgga ggccgcggtg gcccagtctg agcagcaggg tgaggcggcc ctcagtgatg cccgctgcaa gctggccgag ctggagggcg ccctgcagaa ggccaagcag gacatggcct gcctgatcag ggagtaccag gaggtgatga actccaagct gggcctggac atcgagatcg ccacctacag gcgcctgctg gagggcgagg agcagaggct atgtgaaggc attggggctg tgaatgtctg tgtcagcagc tcccggggcg gggtcgtgtg cggggacctc tgcgtgtcag gctcccggcc agtgactggc agtgtctgca gcgctccgtg caacgggaac gtggcggtga gcaccggcct gtgtgcgccc tgcggccaat tgaacaccac ctgcggaggg ggttcctgcg gcgtgggctc ctgtggtatc agctccctgg gtgtggggtc ttgcggcagc agctgccgga aatgttag. It is sometimes possible for the material contained within the vial of "KRT81, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.