Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KRT18 cdna clone

KRT18 cDNA Clone

Gene Names
KRT18; K18; CK-18; CYK18
Synonyms
KRT18; KRT18 cDNA Clone; KRT18 cdna clone
Ordering
For Research Use Only!
Sequence
atgagcttcaccactcgctccaccttctccaccaactaccggtccctgggctctgtccaggcgcccagctacggcgcccggccggtcagcagcgcggccagcgtctatgcaggcgctgggggctctggttcccggatctccgtgtcccgctccaccagcttcaggggcggcatggggtccgggggcctggccaccgggatagccgggggtctggcaggaatgggaggcatccagaacgagaaggagaccatgcaaagcctgaacgaccgcctggcctcttacctggacagagtgaggagcctggagaccgagaaccggaggctggagagcaaaatccgggagcacttggagaagaagggaccccaggtcagagactggagccattacttcaagatcatcgaggacctgagggctcagatcttcgcaaatactgtggacaatgcccgcatcgttctgcagattgacaatgcccgtcttgctgctgatgactttagagtcaagtatgagacagagctggccatgcgccagtctgtggagaacgacatccatgggctccgcaaggtcattgatgacaccaatatcacacgactgcagctggagacagagatcgaggctctcaaggaggagctgctcttcatgaagaagaaccacgaagaggaagtaaaaggcctacaagcccagattgccagctctgggttgaccgtggaggtagatgcccccaaatctcaggacctcgccaagatcatggcagacatccgggcccaatatgacgagctggctcggaagaaccgagaggagctagacaagtactggtctcagcagattgaggagagcaccacagtggtcaccacacagtctgctgaggttggagctgctgagacgacgctcacagagctgagacgtacagtccagtccttggagatcgacctggactccatgagaaatctgaaggccagcttggagaacagcctgagggaggtggaggcccgctacgccctacagatggagcagctcaacgggatcctgctgcaccttgagtcagagctggcacagacccgggcagagggacagcgccaggcccaggagtatgaggccctgctgaacatcaaggtcaagctggaggctgagatcgccacctaccgccgcctgctggaagatggcgaggactttaatcttggtgatgccttggacagcagcaactccatgcaaaccatccaaaagaccaccacccgccggatagtggatggcaaagtggtgtctgagaccaatgacaccaaagttctgaggcattaa
Sequence Length
1293
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
48,058 Da
NCBI Official Full Name
Homo sapiens keratin 18, mRNA
NCBI Official Synonym Full Names
keratin 18
NCBI Official Symbol
KRT18
NCBI Official Synonym Symbols
K18; CK-18; CYK18
NCBI Protein Information
keratin, type I cytoskeletal 18
UniProt Protein Name
Keratin, type I cytoskeletal 18
Protein Family
UniProt Gene Name
KRT18
UniProt Synonym Gene Names
CYK18; CK-18; K18
UniProt Entry Name
K1C18_HUMAN

NCBI Description

KRT18 encodes the type I intermediate filament chain keratin 18. Keratin 18, together with its filament partner keratin 8, are perhaps the most commonly found members of the intermediate filament gene family. They are expressed in single layer epithelial tissues of the body. Mutations in this gene have been linked to cryptogenic cirrhosis. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

K18: a type I cytoskeletal keratin. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. Keratin 18 and its filament partner keratin 8 are perhaps the most commonly found members of the intermediate filament gene family. They are expressed in single layer epithelial tissues of the body. Defects are a cause of cryptogenic cirrhosis.

Protein type: Nucleolus; Cytoskeletal

Chromosomal Location of Human Ortholog: 12q13

Cellular Component: cell-cell adherens junction; cytoplasm; intermediate filament; keratin filament; microtubule organizing center

Molecular Function: protein binding

Biological Process: anatomical structure morphogenesis; Golgi to plasma membrane CFTR protein transport; intermediate filament cytoskeleton organization and biogenesis; negative regulation of apoptosis

Disease: Cirrhosis, Familial

Research Articles on KRT18

Similar Products

Product Notes

The KRT18 krt18 (Catalog #AAA1265669) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagcttca ccactcgctc caccttctcc accaactacc ggtccctggg ctctgtccag gcgcccagct acggcgcccg gccggtcagc agcgcggcca gcgtctatgc aggcgctggg ggctctggtt cccggatctc cgtgtcccgc tccaccagct tcaggggcgg catggggtcc gggggcctgg ccaccgggat agccgggggt ctggcaggaa tgggaggcat ccagaacgag aaggagacca tgcaaagcct gaacgaccgc ctggcctctt acctggacag agtgaggagc ctggagaccg agaaccggag gctggagagc aaaatccggg agcacttgga gaagaaggga ccccaggtca gagactggag ccattacttc aagatcatcg aggacctgag ggctcagatc ttcgcaaata ctgtggacaa tgcccgcatc gttctgcaga ttgacaatgc ccgtcttgct gctgatgact ttagagtcaa gtatgagaca gagctggcca tgcgccagtc tgtggagaac gacatccatg ggctccgcaa ggtcattgat gacaccaata tcacacgact gcagctggag acagagatcg aggctctcaa ggaggagctg ctcttcatga agaagaacca cgaagaggaa gtaaaaggcc tacaagccca gattgccagc tctgggttga ccgtggaggt agatgccccc aaatctcagg acctcgccaa gatcatggca gacatccggg cccaatatga cgagctggct cggaagaacc gagaggagct agacaagtac tggtctcagc agattgagga gagcaccaca gtggtcacca cacagtctgc tgaggttgga gctgctgaga cgacgctcac agagctgaga cgtacagtcc agtccttgga gatcgacctg gactccatga gaaatctgaa ggccagcttg gagaacagcc tgagggaggt ggaggcccgc tacgccctac agatggagca gctcaacggg atcctgctgc accttgagtc agagctggca cagacccggg cagagggaca gcgccaggcc caggagtatg aggccctgct gaacatcaag gtcaagctgg aggctgagat cgccacctac cgccgcctgc tggaagatgg cgaggacttt aatcttggtg atgccttgga cagcagcaac tccatgcaaa ccatccaaaa gaccaccacc cgccggatag tggatggcaa agtggtgtct gagaccaatg acaccaaagt tctgaggcat taa. It is sometimes possible for the material contained within the vial of "KRT18, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.