Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KLRG1 cdna clone

KLRG1 cDNA Clone

Gene Names
KLRG1; 2F1; MAFA; MAFA-L; CLEC15A; MAFA-2F1; MAFA-LIKE
Synonyms
KLRG1; KLRG1 cDNA Clone; KLRG1 cdna clone
Ordering
For Research Use Only!
Sequence
atgactgacagtgttatttattccatgttagagttgcctacggcaacccaagcccagaatgactatggaccacagcaaaaatcttcctcttccaggccttcttgttcttgccttgtggcaatagctttggggcttctgactgcagttcttctgagtgtgctgctataccagtggatcctgtgccagggctccaactactccacttgtgccagctgtcctagctgcccagaccgctggatgaaatatggtaaccattgttattatttctcagtggaggaaaaggactggaattctagtctggaattctgcctagccagagactcacacctccttgtgataacggacaatcaggaaatgagcctgctccaagttttcctcagtgaggccttttgctggattggtctgaggaacaattctggctggaggtgggaagatggatcacctctaaacttctcaaggatttcttctaatagctttgtgcagacatgcggtgccatcaacaaaaatggtcttcaagcctcaagctgtgaagttcctttacactgggtgtgtaagaagtgtccctttgcagatcaagctttattctga
Sequence Length
588
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
21,206 Da
NCBI Official Full Name
Homo sapiens killer cell lectin-like receptor subfamily G, member 1, mRNA
NCBI Official Synonym Full Names
killer cell lectin like receptor G1
NCBI Official Symbol
KLRG1
NCBI Official Synonym Symbols
2F1; MAFA; MAFA-L; CLEC15A; MAFA-2F1; MAFA-LIKE
NCBI Protein Information
killer cell lectin-like receptor subfamily G member 1
UniProt Protein Name
Killer cell lectin-like receptor subfamily G member 1
UniProt Gene Name
KLRG1
UniProt Synonym Gene Names
CLEC15A; MAFA; MAFAL
UniProt Entry Name
KLRG1_HUMAN

NCBI Description

Natural killer (NK) cells are lymphocytes that can mediate lysis of certain tumor cells and virus-infected cells without previous activation. They can also regulate specific humoral and cell-mediated immunity. The protein encoded by this gene belongs to the killer cell lectin-like receptor (KLR) family, which is a group of transmembrane proteins preferentially expressed in NK cells. Studies in mice suggested that the expression of this gene may be regulated by MHC class I molecules. [provided by RefSeq, Jun 2016]

Uniprot Description

KLRG1: Plays an inhibitory role on natural killer (NK) cells and T-cell functions upon binding to their non-MHC ligands. May mediate missing self recognition by binding to a highly conserved site on classical cadherins, enabling it to monitor expression of E-cadherin/CDH1, N-cadherin/CDH2 and R-cadherin/CDH4 on target cells. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 12p13.31

Molecular Function: protein binding; receptor activity

Biological Process: cell surface receptor linked signal transduction; cellular defense response; inflammatory response

Research Articles on KLRG1

Similar Products

Product Notes

The KLRG1 klrg1 (Catalog #AAA1268379) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgactgaca gtgttattta ttccatgtta gagttgccta cggcaaccca agcccagaat gactatggac cacagcaaaa atcttcctct tccaggcctt cttgttcttg ccttgtggca atagctttgg ggcttctgac tgcagttctt ctgagtgtgc tgctatacca gtggatcctg tgccagggct ccaactactc cacttgtgcc agctgtccta gctgcccaga ccgctggatg aaatatggta accattgtta ttatttctca gtggaggaaa aggactggaa ttctagtctg gaattctgcc tagccagaga ctcacacctc cttgtgataa cggacaatca ggaaatgagc ctgctccaag ttttcctcag tgaggccttt tgctggattg gtctgaggaa caattctggc tggaggtggg aagatggatc acctctaaac ttctcaagga tttcttctaa tagctttgtg cagacatgcg gtgccatcaa caaaaatggt cttcaagcct caagctgtga agttccttta cactgggtgt gtaagaagtg tccctttgca gatcaagctt tattctga. It is sometimes possible for the material contained within the vial of "KLRG1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.