Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KLRC4 cdna clone

KLRC4 cDNA Clone

Gene Names
KLRC4; NKG2F; NKG2-F
Synonyms
KLRC4; KLRC4 cDNA Clone; KLRC4 cdna clone
Ordering
For Research Use Only!
Sequence
atgaataaacaaagaggaacctactcagaagtgagtctggcccaggacccaaagaggcagcaaaggaaacttaagggcaataaaatctccatttcaggaaccaaacaggaaatattccaagtagaattaaaccttcaaaatgcttcttcggatcatcaagggaatgacaagacatatcactgcaaaggtttactgccacctccagagaagctcactgctgaggtcctaggaatcatttgcattgtcctgatggccactgtgttaaaaacaatagttcttattccttgtattggagtactggagcagaacaatttttccctgaatagaagaatgcagaaagcacgtcattgtggccattgtcctgaggagtggattacatattccaacagttgttattacattggtaaggaaagaagaacttgggaagaaagagtttgctggcctgtgcttcgaagaactctgatctgctttctatag
Sequence Length
477
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
18,234 Da
NCBI Official Full Name
Homo sapiens killer cell lectin-like receptor subfamily C, member 4, mRNA
NCBI Official Synonym Full Names
killer cell lectin like receptor C4
NCBI Official Symbol
KLRC4
NCBI Official Synonym Symbols
NKG2F; NKG2-F
NCBI Protein Information
NKG2-F type II integral membrane protein
UniProt Protein Name
NKG2-F type II integral membrane protein
UniProt Gene Name
KLRC4
UniProt Synonym Gene Names
NKG2F
UniProt Entry Name
NKG2F_HUMAN

NCBI Description

Natural killer (NK) cells are lymphocytes that can mediate lysis of certain tumor cells and virus-infected cells without previous activation. They can also regulate specific humoral and cell-mediated immunity. NK cells preferentially express several calcium-dependent (C-type) lectins, which have been implicated in the regulation of NK cell function. This gene is a member of the NKG2 group of genes that are expressed primarily in natural killer (NK) cells. These family members encode transmembrane proteins that are characterized by a type II membrane orientation (have an extracellular C-terminus) and the presence of a C-type lectin domain. This family member is located within the NK complex, a region that contains several C-type lectin genes preferentially expressed in NK cells. Read-through transcription exists between this gene and the downstream KLRK1 (killer cell lectin-like receptor subfamily K, member 1) family member. [provided by RefSeq, Dec 2010]

Uniprot Description

KLRC4: May play a role as a receptor for the recognition of MHC class I HLA-E molecules by NK cells.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 12p13.2-p12.3

Biological Process: cellular defense response

Research Articles on KLRC4

Similar Products

Product Notes

The KLRC4 klrc4 (Catalog #AAA1275351) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaataaac aaagaggaac ctactcagaa gtgagtctgg cccaggaccc aaagaggcag caaaggaaac ttaagggcaa taaaatctcc atttcaggaa ccaaacagga aatattccaa gtagaattaa accttcaaaa tgcttcttcg gatcatcaag ggaatgacaa gacatatcac tgcaaaggtt tactgccacc tccagagaag ctcactgctg aggtcctagg aatcatttgc attgtcctga tggccactgt gttaaaaaca atagttctta ttccttgtat tggagtactg gagcagaaca atttttccct gaatagaaga atgcagaaag cacgtcattg tggccattgt cctgaggagt ggattacata ttccaacagt tgttattaca ttggtaagga aagaagaact tgggaagaaa gagtttgctg gcctgtgctt cgaagaactc tgatctgctt tctatag. It is sometimes possible for the material contained within the vial of "KLRC4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.