Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KLK6 cdna clone

KLK6 cDNA Clone

Gene Names
KLK6; hK6; Bssp; Klk7; SP59; PRSS9; PRSS18
Synonyms
KLK6; KLK6 cDNA Clone; KLK6 cdna clone
Ordering
For Research Use Only!
Sequence
atgaagaagctgatggtggtgctgagtctgattgctgcagcctgggcagaggagcagaataagttggtgcatggcggaccctgcgacaagacatctcacccctaccaagctgccctctacacctcgggccacttgctctgtggtggggtccttatccatccactgtgggtcctcacagctgcccactgcaaaaaaccgaatcttcaggtcttcctggggaagcataaccttcggcaaagggagagttcccaggagcagagttctgttgtccgggctgtgatccaccctgactatgatgccgccagccatgaccaggacatcatgctgttgcgcctggcacgcccagccaaactctctgaactcatccagccccttcccctggagagggactgctcagccaacaccaccagctgccacatcctgggctggggcaagacagcagatggtgatttccctgacaccatccagtgtgcatacatccacctggtgtcccgtgaggagtgtgagcatgcctaccctggccagatcacccagaacatgttgtgtgctggggatgagaagtacgggaaggattcctgccagggtgattctgggggtccgctggtatgtggagaccacctccgaggccttgtgtcatggggtaacatcccctgtggatcaaaggagaagccaggagtctacaccaacgtctgcagatacacgaactggatccaaaaaaccattcaggccaagtga
Sequence Length
735
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
4,333 Da
NCBI Official Full Name
Homo sapiens kallikrein-related peptidase 6, mRNA
NCBI Official Synonym Full Names
kallikrein related peptidase 6
NCBI Official Symbol
KLK6
NCBI Official Synonym Symbols
hK6; Bssp; Klk7; SP59; PRSS9; PRSS18
NCBI Protein Information
kallikrein-6
UniProt Protein Name
Kallikrein-6
Protein Family
UniProt Gene Name
KLK6
UniProt Synonym Gene Names
PRSS18; PRSS9
UniProt Entry Name
KLK6_HUMAN

NCBI Description

This gene encodes a member of the kallikrein subfamily of the peptidase S1 family of serine proteases. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. The encoded preproprotein is proteolytically processed to generate the mature protease. Expression of this protease is regulated by steroid hormones and may be elevated in multiple human cancers and in serum from psoriasis patients. The encoded protease may participate in the cleavage of amyloid precursor protein and alpha-synuclein, thus implicating this protease in Alzheimer's and Parkinson's disease, respectively. This gene is located in a gene cluster on chromosome 19. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Feb 2016]

Uniprot Description

KLK6: Serine protease which exhibits a preference for Arg over Lys in the substrate P1 position and for Ser or Pro in the P2 position. Shows activity against amyloid precursor protein, myelin basic protein, gelatin, casein and extracellular matrix proteins such as fibronectin, laminin, vitronectin and collagen. Degrades alpha-synuclein and prevents its polymerization, indicating that it may be involved in the pathogenesis of Parkinson disease and other synucleinopathies. May be involved in regulation of axon outgrowth following spinal cord injury. Tumor cells treated with a neutralizing KLK6 antibody migrate less than control cells, suggesting a role in invasion and metastasis. Belongs to the peptidase S1 family. Kallikrein subfamily. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Secreted, signal peptide; Protease; Nucleolus; EC 3.4.21.-; Secreted

Chromosomal Location of Human Ortholog: 19q13.3

Cellular Component: cytoplasm; extracellular region; extracellular space; intercellular bridge; microtubule cytoskeleton; nuclear membrane; nucleoplasm

Molecular Function: protein binding; serine-type endopeptidase activity

Biological Process: positive regulation of G-protein coupled receptor protein signaling pathway; protein processing

Research Articles on KLK6

Similar Products

Product Notes

The KLK6 klk6 (Catalog #AAA1266805) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagaagc tgatggtggt gctgagtctg attgctgcag cctgggcaga ggagcagaat aagttggtgc atggcggacc ctgcgacaag acatctcacc cctaccaagc tgccctctac acctcgggcc acttgctctg tggtggggtc cttatccatc cactgtgggt cctcacagct gcccactgca aaaaaccgaa tcttcaggtc ttcctgggga agcataacct tcggcaaagg gagagttccc aggagcagag ttctgttgtc cgggctgtga tccaccctga ctatgatgcc gccagccatg accaggacat catgctgttg cgcctggcac gcccagccaa actctctgaa ctcatccagc cccttcccct ggagagggac tgctcagcca acaccaccag ctgccacatc ctgggctggg gcaagacagc agatggtgat ttccctgaca ccatccagtg tgcatacatc cacctggtgt cccgtgagga gtgtgagcat gcctaccctg gccagatcac ccagaacatg ttgtgtgctg gggatgagaa gtacgggaag gattcctgcc agggtgattc tgggggtccg ctggtatgtg gagaccacct ccgaggcctt gtgtcatggg gtaacatccc ctgtggatca aaggagaagc caggagtcta caccaacgtc tgcagataca cgaactggat ccaaaaaacc attcaggcca agtga. It is sometimes possible for the material contained within the vial of "KLK6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.