Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KLHL3 cdna clone

KLHL3 cDNA Clone

Gene Names
KLHL3; PHA2D
Synonyms
KLHL3; KLHL3 cDNA Clone; KLHL3 cdna clone
Ordering
For Research Use Only!
Sequence
atggagggtgaaagtgtcaagctgagctcccagactctgatacaggctggggatgatgagaagaaccagaggacgatcactgtcaaccctgcccacatggggaaagcattcaaggttatgaatgaactgcggagtaaacagctgttgtgtgacgtgatgattgtggcagaagatgtcgagatagaagcccaccgtgtggtcctggcagcctgcagcccctacttctgtgcgatgttcacaggtgacatgtctgagagtaaagccaaaaagatagaaatcaaggacgtggatgggcagacgctgagtaagctgattgactacatctatactgctgaaatcgaggtgactgaagagaatgtccaggtgctgctcccggcagccagcttgctgcagctcatggatgttcggcagaactgctgtgacttcctgcagtctcagttgcatcccaccaattgcctgggcatccgtgcgtttgcagatgtacacacctgcactgaccttctgcagcaggccaatgcctacgcagagcagcactttccagaggtgatgctaggagaagaatttcttagcctgagtctggaccaggtgtgcagcttgatatccagcgacaagctgaccgtttcttcagaagagaaggtgtttgaagctgtgatctcatggatcaattatgagaaagaaacccgtttagagcacatggcaaagctgatggaacatgtccgacttcctctcttacctagggactacctagtccaaacggttgaagaagaagctttgataaagaataacaacacctgtaaagacttcctcattgaggccatgaaataccatctcctccctctggatcagagactattgattaagaacccaaggaccaagcccaggactccagtcagccttcccaagtag
Sequence Length
906
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
55,927 Da
NCBI Official Full Name
Homo sapiens kelch-like 3 (Drosophila), mRNA
NCBI Official Synonym Full Names
kelch like family member 3
NCBI Official Symbol
KLHL3
NCBI Official Synonym Symbols
PHA2D
NCBI Protein Information
kelch-like protein 3
UniProt Protein Name
Kelch-like protein 3
Protein Family
UniProt Gene Name
KLHL3
UniProt Synonym Gene Names
KIAA1129
UniProt Entry Name
KLHL3_HUMAN

NCBI Description

This gene is ubiquitously expressed and encodes a full-length protein which has an N-terminal BTB domain followed by a BACK domain and six kelch-like repeats in the C-terminus. These kelch-like repeats promote substrate ubiquitination of bound proteins via interaction of the BTB domain with the CUL3 (cullin 3) component of a cullin-RING E3 ubiquitin ligase (CRL) complex. Muatations in this gene cause pseudohypoaldosteronism type IID (PHA2D); a rare Mendelian syndrome featuring hypertension, hyperkalaemia and metabolic acidosis. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Mar 2012]

Uniprot Description

KLHL3: Substrate-specific adapter of a BCR (BTB-CUL3-RBX1) E3 ubiquitin ligase complex that acts as a regulator of ion transport in the distal nephron. The BCR(KLHL3) complex may act by mediating ubiquitination of SLC12A3/NCC, thereby regulating SLC12A3/NCC subcellular location at the cell membrane. Defects in KLHL3 are the cause of Pseudohypoaldosteronism type 2D (PHA2D). A disorder characterized by severe hypertension, hyperkalemia, hyperchloremia, hyperchloremic metabolic acidosis, and correction of physiologic abnormalities by thiazide diuretics. PHA2D inheritance is autosomal dominant or recessive. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Cytoskeletal; Actin-binding

Chromosomal Location of Human Ortholog: 5q31

Cellular Component: cytosol

Molecular Function: protein binding; structural molecule activity; ubiquitin-protein ligase activity

Biological Process: ion homeostasis; protein ubiquitination; protein ubiquitination during ubiquitin-dependent protein catabolic process

Disease: Pseudohypoaldosteronism, Type Iid

Research Articles on KLHL3

Similar Products

Product Notes

The KLHL3 klhl3 (Catalog #AAA1269018) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagggtg aaagtgtcaa gctgagctcc cagactctga tacaggctgg ggatgatgag aagaaccaga ggacgatcac tgtcaaccct gcccacatgg ggaaagcatt caaggttatg aatgaactgc ggagtaaaca gctgttgtgt gacgtgatga ttgtggcaga agatgtcgag atagaagccc accgtgtggt cctggcagcc tgcagcccct acttctgtgc gatgttcaca ggtgacatgt ctgagagtaa agccaaaaag atagaaatca aggacgtgga tgggcagacg ctgagtaagc tgattgacta catctatact gctgaaatcg aggtgactga agagaatgtc caggtgctgc tcccggcagc cagcttgctg cagctcatgg atgttcggca gaactgctgt gacttcctgc agtctcagtt gcatcccacc aattgcctgg gcatccgtgc gtttgcagat gtacacacct gcactgacct tctgcagcag gccaatgcct acgcagagca gcactttcca gaggtgatgc taggagaaga atttcttagc ctgagtctgg accaggtgtg cagcttgata tccagcgaca agctgaccgt ttcttcagaa gagaaggtgt ttgaagctgt gatctcatgg atcaattatg agaaagaaac ccgtttagag cacatggcaa agctgatgga acatgtccga cttcctctct tacctaggga ctacctagtc caaacggttg aagaagaagc tttgataaag aataacaaca cctgtaaaga cttcctcatt gaggccatga aataccatct cctccctctg gatcagagac tattgattaa gaacccaagg accaagccca ggactccagt cagccttccc aagtag. It is sometimes possible for the material contained within the vial of "KLHL3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.