Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KLHL25 cdna clone

KLHL25 cDNA Clone

Gene Names
KLHL25; ENC2; ENC-2
Synonyms
KLHL25; KLHL25 cDNA Clone; KLHL25 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcggtcagtgtccatgagacccgcaagtcgcggagcagcacggggtccatgaacgtcaccctcttccacaaggcctcccacccggactgtgtgctggcccacctcaacacgcttcgcaagcactgcatgttcaccgacgtcacactctgggcgggcgaccgtgccttcccctgtcaccgtgccgtgctggccgcctctagccgctattttgaggccatgttcagccatggccttcgggagagccgggatgacactgtcaacttccaggacaacctgcacccggaggtgctggagctgctgctggactttgcctactcctcacgcatcgccatcaacgaggagaacgctgagtcactgctggaggcaggcgacatgctgcagttccacgatgtgcgggatgctgccgccgagttcctggagaagaaccttttcccctccaactgcctgggcatgatgctgctctcggacgcccaccagtgccgccggctgtatgagttctcctggcgcatgtgcctggtgcactttgagacggtgaggcagagcgaggacttcaacagcctgtccaaggacacactgctggacctcatctcgagtgatgagctggagaccgaggacgagcgggtggtcttcgaggccatcctccagtgggtgaagcacgacctggagccacggaaggtccacttgcccgagctcctccgcagcgtgcgtctggccttgctgccgtccgactgcctgcaggaggccgtctccagcgaggccctcctcatggcagacgagcgcaccaagcttatcatggatgaggccctgcgctgcaagaccaggatcctgcagaatgatggcgtggtcaccagcccctgtgcccggccacgcaaggcgggccacacgctactcatcctggggggccagaccttcatgtgtgacaagatctaccaggtggaccacaaggccaaggagatcatccccaaggccgacctgcccagcccccggaaggagttcagcgcctcagcgatcggctgcaaggtctatgtgacggggggcaggggctccgagaacggggtctccaaggatgtctgggtgtacgacaccgtacatgaggaatggtccaaggcggcgcccatgctgattgcccgctttggccatggctcagctgagctggagaactgcctctatgtggtggggggacacacatccctggcaggggtcttcccggcctcgccttctgtctccctgaaacaagtggagaaatacgaccctggggccaacaagtggatgatggtggcccccttgcgggatggcgtcagcaatgccgcagtggtgagtgccaagctgaagctctttgttttcggaggaaccagcatccaccgggacatggtgtccaaggtccagtgctatgacccctcggagaacaggtggacgatcaaggccgagtgcccccagccttggcggtacacagccgctgccgtcctgggcagccagatcttcatcatgggaggtgacacggaattcacagccgcctcggcctaccgctttgactgtgagaccaaccagtggacgcggattggggacatgactgccaagcgcatgtcctgccatgccctggcttccggcaacaagctctatgtggtcgggggctactttgggacccagaggtgtaagactctggactgctatgaccccacttcagatacatggaactgcatcaccacagtgccctactcacttatccccacggcctttgtcagcacctggaagcacctgcccgcgtga
Sequence Length
1770
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
65,923 Da
NCBI Official Full Name
Homo sapiens kelch-like 25 (Drosophila), mRNA
NCBI Official Synonym Full Names
kelch like family member 25
NCBI Official Symbol
KLHL25
NCBI Official Synonym Symbols
ENC2; ENC-2
NCBI Protein Information
kelch-like protein 25
UniProt Protein Name
Kelch-like protein 25
Protein Family
UniProt Gene Name
KLHL25
UniProt Synonym Gene Names
ENC2; ENC-2
UniProt Entry Name
KLH25_HUMAN

Uniprot Description

KLHL25: Substrate-specific adapter of a BCR (BTB-CUL3-RBX1) E3 ubiquitin ligase complex required for translational homeostasis. The BCR(KLHL25) ubiquitin ligase complex acts by mediating ubiquitination of hypophosphorylated EIF4EBP1 (4E-BP1): ubiquitination and subsequent degradation of hypophosphorylated EIF4EBP1 (4E-BP1) probably serves as a homeostatic mechanism to maintain translation and prevent eIF4E inhibition when eIF4E levels are low. The BCR(KLHL25) complex does not target EIF4EBP1 (4E-BP1) when it is hyperphosphorylated or associated with eIF4E. Component of the BCR(KLHL25) E3 ubiquitin ligase complex, at least composed of CUL3, KLHL25 and RBX1. Interacts with EIF4EBP1 (when hypophosphorylated)

Protein type: Unknown function

Chromosomal Location of Human Ortholog: 15q25.3

Cellular Component: cytoplasm

Biological Process: protein ubiquitination; protein ubiquitination during ubiquitin-dependent protein catabolic process; regulation of translational initiation

Similar Products

Product Notes

The KLHL25 klhl25 (Catalog #AAA1274298) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcggtca gtgtccatga gacccgcaag tcgcggagca gcacggggtc catgaacgtc accctcttcc acaaggcctc ccacccggac tgtgtgctgg cccacctcaa cacgcttcgc aagcactgca tgttcaccga cgtcacactc tgggcgggcg accgtgcctt cccctgtcac cgtgccgtgc tggccgcctc tagccgctat tttgaggcca tgttcagcca tggccttcgg gagagccggg atgacactgt caacttccag gacaacctgc acccggaggt gctggagctg ctgctggact ttgcctactc ctcacgcatc gccatcaacg aggagaacgc tgagtcactg ctggaggcag gcgacatgct gcagttccac gatgtgcggg atgctgccgc cgagttcctg gagaagaacc ttttcccctc caactgcctg ggcatgatgc tgctctcgga cgcccaccag tgccgccggc tgtatgagtt ctcctggcgc atgtgcctgg tgcactttga gacggtgagg cagagcgagg acttcaacag cctgtccaag gacacactgc tggacctcat ctcgagtgat gagctggaga ccgaggacga gcgggtggtc ttcgaggcca tcctccagtg ggtgaagcac gacctggagc cacggaaggt ccacttgccc gagctcctcc gcagcgtgcg tctggccttg ctgccgtccg actgcctgca ggaggccgtc tccagcgagg ccctcctcat ggcagacgag cgcaccaagc ttatcatgga tgaggccctg cgctgcaaga ccaggatcct gcagaatgat ggcgtggtca ccagcccctg tgcccggcca cgcaaggcgg gccacacgct actcatcctg gggggccaga ccttcatgtg tgacaagatc taccaggtgg accacaaggc caaggagatc atccccaagg ccgacctgcc cagcccccgg aaggagttca gcgcctcagc gatcggctgc aaggtctatg tgacgggggg caggggctcc gagaacgggg tctccaagga tgtctgggtg tacgacaccg tacatgagga atggtccaag gcggcgccca tgctgattgc ccgctttggc catggctcag ctgagctgga gaactgcctc tatgtggtgg ggggacacac atccctggca ggggtcttcc cggcctcgcc ttctgtctcc ctgaaacaag tggagaaata cgaccctggg gccaacaagt ggatgatggt ggcccccttg cgggatggcg tcagcaatgc cgcagtggtg agtgccaagc tgaagctctt tgttttcgga ggaaccagca tccaccggga catggtgtcc aaggtccagt gctatgaccc ctcggagaac aggtggacga tcaaggccga gtgcccccag ccttggcggt acacagccgc tgccgtcctg ggcagccaga tcttcatcat gggaggtgac acggaattca cagccgcctc ggcctaccgc tttgactgtg agaccaacca gtggacgcgg attggggaca tgactgccaa gcgcatgtcc tgccatgccc tggcttccgg caacaagctc tatgtggtcg ggggctactt tgggacccag aggtgtaaga ctctggactg ctatgacccc acttcagata catggaactg catcaccaca gtgccctact cacttatccc cacggccttt gtcagcacct ggaagcacct gcccgcgtga. It is sometimes possible for the material contained within the vial of "KLHL25, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.