KLHL22 cdna clone
KLHL22 cDNA Clone
Gene Names
KLHL22; KELCHL
Synonyms
KLHL22; KLHL22 cDNA Clone; KLHL22 cdna clone
Sequence
atggcagaggagcaggagttcacccagctctgcaagttgcctgcacagccctcacacccacactgcgtgaacaacacctaccgcagcgcacagcactcccaggctctgctccgagggctgctggctctccgggacagcggaatcctcttcgatgttgtgctggtggtggagggcagacacatcgaggcccatcgcatcctgctggctgcgtcctgcgattacttcagaggaatgtttgctgggggattgaaggagatggaacaggaagaggtcctgatccacggtgtgtcctacaatgctatgtgccaaatcctacatttcatatacacctccgagctggagctcagcctgagcaatgtacaagagacactggtggctgcctgccagcttcagatcccagaaattatccatttctgctgtgatttcctcatgtcctgggtggacgaagagaacattctcgatgtctaccggctggcagagctgtttgacttgagccgcctgactgagcaactggacacctatatcctcaaaaactttgtggccttctctcggactgacaagtaccgccagcttccattggagaaggtctactccctcctcagcagcaatcgcctggaggtctcctgcgagaccgaggtatatgagggggcccttctctaccattatagcctggagcaggtgcaggctgaccagatctcgctgcacgagcccccaaagctccttgagacagtgcggtttccgctgatggaagctgaggtcctgcagcggctgcatgacaagctggaccccagccctttgagggacacagtggccagcgccctcatgtaccaccggaacgagagcctacagcccagcctgcagagcccgcaaacggagctgcggtcggacttccagtgcgttgtgggcttcgggggcattcactccacgccgtccactgtcctcagcgaccaggccaagtatctaaaccccttactgggagagtggaagcacttcactgcctccctggccccccgcatgtccaaccagggcatcgcggtgctcaacaacttcgtatacttgattggaggggacaacaatgtccaaggatttcgagcagagtcccgatgctggaggtatgacccacggcacaaccgctggttccagatccagtccctgcagcaggagcacgccgacctgtccgtgtgtgttgtaggcaggtacatctacgctgtggcgggccgtgactaccacaatgacctgaatgctgtggagcgctacgaccctgccaccaactcctgggcatacgtggccccactcaagagggaggtgtatgcccacgcaggcgcgacgctggaggggaagatgtatatcacctgcggccgcagaggggaggattacctgaaagagacacactgctacgatccaggcagcaacacttggcacacactggctgatgggcctgtgcggcgcgcctggcacggcatggcaaccctcctcaacaagctgtatgtgatcgggggcagcaacaacgatgccggatacaggagggacgtgcaccaggtggcctgctacagctgcacgtctggacagtggtcatctgtctgcccactccctgctgggcacggtgagcctggcattgctgtgctggacaacaggatctatgtgttaggtggccgctcacacaaccgcggcagccgcacaggctacgtgcacatttacgatgtggagaaggactgctgggaggaagggccccagctggacaactccatctcaggcctggcggcctgtgtgctcaccctgccccgctccctgctccttgagccgccccgcgggacccctgaccgcagccaggccgacccggactttgcctctgaggtgatgagtgtgtctgactgggaggagtttgacaactccagtgaggactag
Sequence Length
1905
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
55,567 Da
NCBI Official Full Name
Homo sapiens kelch-like 22 (Drosophila), mRNA
NCBI Official Synonym Full Names
kelch like family member 22
NCBI Official Symbol
KLHL22
NCBI Official Synonym Symbols
KELCHL
NCBI Protein Information
kelch-like protein 22
UniProt Protein Name
Kelch-like protein 22
Protein Family
UniProt Gene Name
KLHL22
UniProt Entry Name
KLH22_HUMAN
Uniprot Description
KLHL22: Substrate-specific adapter of a BCR (BTB-CUL3-RBX1) E3 ubiquitin ligase complex required for cell division. BCR E3 ubiquitin ligase complexes mediate the ubiquitination of target proteins.
Chromosomal Location of Human Ortholog: 22q11.21
Cellular Component: centrosome; cytoplasm; polar microtubule
Molecular Function: protein binding; ubiquitin-protein ligase activity
Biological Process: cell division; mitotic cell cycle spindle assembly checkpoint; mitotic sister chromatid segregation; protein monoubiquitination
Research Articles on KLHL22
Similar Products
Product Notes
The KLHL22 klhl22 (Catalog #AAA1273589) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagagg agcaggagtt cacccagctc tgcaagttgc ctgcacagcc ctcacaccca cactgcgtga acaacaccta ccgcagcgca cagcactccc aggctctgct ccgagggctg ctggctctcc gggacagcgg aatcctcttc gatgttgtgc tggtggtgga gggcagacac atcgaggccc atcgcatcct gctggctgcg tcctgcgatt acttcagagg aatgtttgct gggggattga aggagatgga acaggaagag gtcctgatcc acggtgtgtc ctacaatgct atgtgccaaa tcctacattt catatacacc tccgagctgg agctcagcct gagcaatgta caagagacac tggtggctgc ctgccagctt cagatcccag aaattatcca tttctgctgt gatttcctca tgtcctgggt ggacgaagag aacattctcg atgtctaccg gctggcagag ctgtttgact tgagccgcct gactgagcaa ctggacacct atatcctcaa aaactttgtg gccttctctc ggactgacaa gtaccgccag cttccattgg agaaggtcta ctccctcctc agcagcaatc gcctggaggt ctcctgcgag accgaggtat atgagggggc ccttctctac cattatagcc tggagcaggt gcaggctgac cagatctcgc tgcacgagcc cccaaagctc cttgagacag tgcggtttcc gctgatggaa gctgaggtcc tgcagcggct gcatgacaag ctggacccca gccctttgag ggacacagtg gccagcgccc tcatgtacca ccggaacgag agcctacagc ccagcctgca gagcccgcaa acggagctgc ggtcggactt ccagtgcgtt gtgggcttcg ggggcattca ctccacgccg tccactgtcc tcagcgacca ggccaagtat ctaaacccct tactgggaga gtggaagcac ttcactgcct ccctggcccc ccgcatgtcc aaccagggca tcgcggtgct caacaacttc gtatacttga ttggagggga caacaatgtc caaggatttc gagcagagtc ccgatgctgg aggtatgacc cacggcacaa ccgctggttc cagatccagt ccctgcagca ggagcacgcc gacctgtccg tgtgtgttgt aggcaggtac atctacgctg tggcgggccg tgactaccac aatgacctga atgctgtgga gcgctacgac cctgccacca actcctgggc atacgtggcc ccactcaaga gggaggtgta tgcccacgca ggcgcgacgc tggaggggaa gatgtatatc acctgcggcc gcagagggga ggattacctg aaagagacac actgctacga tccaggcagc aacacttggc acacactggc tgatgggcct gtgcggcgcg cctggcacgg catggcaacc ctcctcaaca agctgtatgt gatcgggggc agcaacaacg atgccggata caggagggac gtgcaccagg tggcctgcta cagctgcacg tctggacagt ggtcatctgt ctgcccactc cctgctgggc acggtgagcc tggcattgct gtgctggaca acaggatcta tgtgttaggt ggccgctcac acaaccgcgg cagccgcaca ggctacgtgc acatttacga tgtggagaag gactgctggg aggaagggcc ccagctggac aactccatct caggcctggc ggcctgtgtg ctcaccctgc cccgctccct gctccttgag ccgccccgcg ggacccctga ccgcagccag gccgacccgg actttgcctc tgaggtgatg agtgtgtctg actgggagga gtttgacaac tccagtgagg actag. It is sometimes possible for the material contained within the vial of "KLHL22, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
