KLHL2 cdna clone
KLHL2 cDNA Clone
Gene Names
KLHL2; MAV; MAYVEN; ABP-KELCH
Synonyms
KLHL2; KLHL2 cDNA Clone; KLHL2 cdna clone
Sequence
atggagacgccgccgctgcctcccgcatgcacaaagcagggtcatcagaagcctctcgattcaaaagatgataataccgaaaaacactgcccagtgacagtgaatccttggcatatgaagaaagctttcaaagtcatgaacgaattaagaagtcaaaatttgctgtgcgatgtcacaattgtggcagaagacatggaaatttctgctcatagagtggtgctggccgcctgtagtccttattttcatgccatgtttacaggtgagatgagtgagagccgagcaaagagagttagaataaaagaggtagatggctggaccctgaggatgctaattgattatgtttacactgcagaaattcaggttacagaagaaaatgtacaggtacttctcccagcagctggtctcttacagttacaggatgtgaagaagacttgttgtgaatttttggaatcccagcttcaccctgtcaactgcttaggaatccgggcttttgctgatatgcatgcatgtaccgaccttctgaacaaggccaacacctatgcagagcaacattttgcagatgttgtacttagtgaagaatttctcaatcttggcatcgaacaagtgtgcagcttaatctcaagtgacaaacttaccatttcttcagaagagaaggtatttgaagcagtaatagcatgggtgaaccatgacaaggatgtgaggcaagagtttatggcccgactgatggaacatgtacggttacctttgcttcctcgggaatatttagttcagagggttgaagaggaagcattggtcaagaatagcagtgcttgcaaagattacctcattgaagcaatgaagtaccatttgctgccaacagagcagcgtatattaatgaagagtgtccggacccggctgaggacacccatgaaccttcccaaattgatggtggtggttgggggccaagcaccaaaggctatccggagtgtggaatgctatgactttaaagaagaaaggtggcaccaagtagcagagttgccttccgggaggtgcagggcaggcatggtctacatggctggacttgtttttgctgttggtggctttaatggctcattaagagttcgcactgtagattcctacgaccctgtgaaggaccagtggaccagcgttgctaacatgagagaccggagaagcactttgggagctgctgtgttaaatggattattatacgctgtgggaggctttgatgggagtacaggtttgtcatctgtggaagcatacaacataaagtctaatgagtggtttcatgtagctcccatgaatacaaggaggagcagtgttggtgtgggtgttgttggaggtttgctctatgctgtaggaggttatgatggagcatcacgtcagtgtcttagcacagtagaatgctataatgctacaacaaatgagtggacctatatagcagaaatgagcaccaggcggagtggagcaggtgttggtgtgttaaacaatttattgtatgctgtaggaggtcatgatggccctttagtacgaaaaagtgttgaagtatatgatcccaccactaacgcatggagacaggttgcagatatgaacatgtgcagaagaaatgcaggagtttgtgcagttaatggtctgttatatgttgttggaggggatgatggttcctgtaacttggcgtcagtagaatattataacccaacaaccgataaatggacagttgtgtcatcgtgtatgagcacagggagaagttatgcaggggtcacagttattgataaaccattatga
Sequence Length
1782
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
56,086 Da
NCBI Official Full Name
Homo sapiens kelch-like 2, Mayven (Drosophila), mRNA
NCBI Official Synonym Full Names
kelch like family member 2
NCBI Official Symbol
KLHL2
NCBI Official Synonym Symbols
MAV; MAYVEN; ABP-KELCH
NCBI Protein Information
kelch-like protein 2
UniProt Protein Name
Kelch-like protein 2
Protein Family
UniProt Gene Name
KLHL2
UniProt Entry Name
KLHL2_HUMAN
Uniprot Description
KLHL2: May play a role in organizing the actin cytoskeleton of the brain cells. 2 isoforms of the human protein are produced by alternative splicing.
Chromosomal Location of Human Ortholog: 4q21.2
Cellular Component: actin cytoskeleton; cytoplasm
Molecular Function: actin binding; protein binding; ubiquitin-protein ligase activity
Biological Process: protein ubiquitination
Research Articles on KLHL2
Similar Products
Product Notes
The KLHL2 klhl2 (Catalog #AAA1273637) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagacgc cgccgctgcc tcccgcatgc acaaagcagg gtcatcagaa gcctctcgat tcaaaagatg ataataccga aaaacactgc ccagtgacag tgaatccttg gcatatgaag aaagctttca aagtcatgaa cgaattaaga agtcaaaatt tgctgtgcga tgtcacaatt gtggcagaag acatggaaat ttctgctcat agagtggtgc tggccgcctg tagtccttat tttcatgcca tgtttacagg tgagatgagt gagagccgag caaagagagt tagaataaaa gaggtagatg gctggaccct gaggatgcta attgattatg tttacactgc agaaattcag gttacagaag aaaatgtaca ggtacttctc ccagcagctg gtctcttaca gttacaggat gtgaagaaga cttgttgtga atttttggaa tcccagcttc accctgtcaa ctgcttagga atccgggctt ttgctgatat gcatgcatgt accgaccttc tgaacaaggc caacacctat gcagagcaac attttgcaga tgttgtactt agtgaagaat ttctcaatct tggcatcgaa caagtgtgca gcttaatctc aagtgacaaa cttaccattt cttcagaaga gaaggtattt gaagcagtaa tagcatgggt gaaccatgac aaggatgtga ggcaagagtt tatggcccga ctgatggaac atgtacggtt acctttgctt cctcgggaat atttagttca gagggttgaa gaggaagcat tggtcaagaa tagcagtgct tgcaaagatt acctcattga agcaatgaag taccatttgc tgccaacaga gcagcgtata ttaatgaaga gtgtccggac ccggctgagg acacccatga accttcccaa attgatggtg gtggttgggg gccaagcacc aaaggctatc cggagtgtgg aatgctatga ctttaaagaa gaaaggtggc accaagtagc agagttgcct tccgggaggt gcagggcagg catggtctac atggctggac ttgtttttgc tgttggtggc tttaatggct cattaagagt tcgcactgta gattcctacg accctgtgaa ggaccagtgg accagcgttg ctaacatgag agaccggaga agcactttgg gagctgctgt gttaaatgga ttattatacg ctgtgggagg ctttgatggg agtacaggtt tgtcatctgt ggaagcatac aacataaagt ctaatgagtg gtttcatgta gctcccatga atacaaggag gagcagtgtt ggtgtgggtg ttgttggagg tttgctctat gctgtaggag gttatgatgg agcatcacgt cagtgtctta gcacagtaga atgctataat gctacaacaa atgagtggac ctatatagca gaaatgagca ccaggcggag tggagcaggt gttggtgtgt taaacaattt attgtatgct gtaggaggtc atgatggccc tttagtacga aaaagtgttg aagtatatga tcccaccact aacgcatgga gacaggttgc agatatgaac atgtgcagaa gaaatgcagg agtttgtgca gttaatggtc tgttatatgt tgttggaggg gatgatggtt cctgtaactt ggcgtcagta gaatattata acccaacaac cgataaatgg acagttgtgt catcgtgtat gagcacaggg agaagttatg caggggtcac agttattgat aaaccattat ga. It is sometimes possible for the material contained within the vial of "KLHL2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
